Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for 2' 5' Dichloro 3 3 4 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... for 3 days with macrophage-conditioned medium containing 2% Horse Serum (Gibco). Cells were washed ...
-
bioRxiv - Cell Biology 2020Quote: ... spiked with 2-3 μL Plus reagent (15338100, Thermo Fisher Scientific, USA). The plasmid solution was mixed and incubated for 10 min at room temperature ...
-
bioRxiv - Pathology 2022Quote: ... 2 and 3 were quantified using CyQUANT Proliferation Assay Kit (Invitrogen, C35011); For myofibroblast differentiation assay ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dynabeads with precipitated proteins were washed 3 times with DynaMag-2 (Invitrogen) and eluted with LDS buffer (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... and TaqMan assay reagents (Table 2) on the QuantStudio 3 (Applied Biosystems). Gene expression was normalized to GAPDH expression ...
-
bioRxiv - Cell Biology 2023Quote: ... 2- & 3-methyl pentane and n-hexane (Thermo Scientific, Waltham, MA, USA). Reported compounds detected by the GC-MS were confirmed by matching retention times and mass–charge (m/z ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were split every 2 to 3 days using TrypLE Express (Gibco).
-
bioRxiv - Immunology 2023Quote: ... 3) Dyes: NucBlue Live Cell Stain (2 drops/ml, R37605, Molecular Probes), phalloidin-568 (A12380 ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: Cells were passaged every 2-3 days by incubation with Accutase (Gibco) for 2-3 min at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... A 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (M2128, Invitrogen) solution was prepared at a final concentration of 0.5 mg/mL and pH 7.4 ...
-
bioRxiv - Genetics 2024Quote: ... transfected cells were selected using 2-3 µg puromycin (Thermo Fisher Scientific) until all cells in non-transfected control were dead ...
-
bioRxiv - Neuroscience 2024Quote: ... This medium was exchanged 2-3 hours after plating with Neurobasal (Gibco) supplemented with L-glutamine (2 mM) ...
-
bioRxiv - Pathology 2023Quote: ... were incubated with 10 µM red fluorescent Lipophilic Tracer DiD (1,1’-dioctadecyl-3, 3, 39, 39-tetramethylindodicarbocyanine, 4-chlorobenzenesulfonate salt; Thermo Fisher Scientific, Waltham, MA, USA) and/or 2 mM SYTO RNA-Select Green Fluorescent Cell Stain Kit (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 3×(CAC)2 and (CAC)2 RNAs were transcribed using T7 RNA polymerase (Thermofisher Scientific). A 10 μl binding reaction contains 10 nM RNA ...
-
bioRxiv - Cell Biology 2021Quote: ... Rev: 5’-TCATTGAGACACCATTTGTC-3’ were cloned into pCR™4-TOPO® TA vector using the TOPO-TA cloning kit (Thermo Fisher 450030) and sequence verified.
-
bioRxiv - Microbiology 2020Quote: ... 10 ml l1 glycerol and 20 g l−1 Bacto agar) supplemented with 25 µg ml−1 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal, Thermo Fisher Scientific). Overnight cultures of the control strains were normalized to OD600 = 1.0 and inoculated as 20 µl spots on the agar plates containing the biosensor ...
-
bioRxiv - Cell Biology 2024Quote: ... or luciferase siRNA (5’ CGUACGCGGAAUACUUCGA 3’, control) were transfected in above RPE1 cells using 4 µl of lipofectamine siRNAmax (Thermo Fisher Scientific, 13778075) and 10 µM of siRNA in 2 ml of cell culture media ...
-
bioRxiv - Synthetic Biology 2024Quote: ... HEK293FT and HEK293FT-LP cells were subcultured at a 1:5 to 1:10 ratio every 2–3 d using Trypsin-EDTA (Gibco 25300-054). All HEK293FT cell lines generated by engineering either the HEK293FT or HEK293FT-LP parent cell lines were cultured in the same way ...
-
bioRxiv - Neuroscience 2023Quote: ... Slides were washed 3×5 min in PBS and incubated for 2 h with an Alexa Fluor® Plus 555-conjugated secondary antibody (Invitrogen A32816) diluted in the blocking solution ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of MVs were incubated with the FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Thermofisher) at 2 µg/mL in a final volume of 100 µL in a 96-well black plate ...
-
bioRxiv - Immunology 2021Quote: ... on the QuantStudio 5 or QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Relative transcript levels were normalized to TATA-binding protein (Tbp ...
-
bioRxiv - Molecular Biology 2021Quote: ... and CAF-1 p60 (5′-AAUCUUGCUCGUCAUACCA-3′) were transfected using RNAi MAX (Invitrogen).
-
bioRxiv - Genomics 2020Quote: ... or a positive control probe 5’-5Alexa488N/(ATA)8TUU (ATA)7-3’ (Invitrogen). Reactions were incubated in a water bath at 37°C for 2 hrs ...
-
bioRxiv - Cancer Biology 2020Quote: Non-targeting control (CTRL) (Dharmacon) 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3′-end fluorescent labeling of the RNAs with fluorescein-5-thiosemicarbazide (ThermoFisher Scientific) was done as previously reported (Grozdanov and Stocco ...
-
bioRxiv - Microbiology 2020Quote: ... 3 to 5 colonies were transferred in Mueller-Hinton broth (Thermo Scientific Oxoid) and adjusted to an optical density at 600nm (OD ...
-
bioRxiv - Immunology 2020Quote: Pieces of 3 mm3 tumors were submerged in 5 vol of RNAlater (Invitrogen) (n = 5 samples/group) ...
-
bioRxiv - Developmental Biology 2020Quote: 3 × 106 ESC cells were distributed to 5 12-well dishes (Thermo Scientific) with 5 × 105 mESC cells per well ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl RNA (2ng/μg) and 3 μl of 5x Primer stock (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Amplifications were run on a QuantStudio 3 or 5 thermal cycler (Thermo Fisher) and results were analyzed using the instrument software ...
-
bioRxiv - Cell Biology 2023Quote: ... vector encoding a sgRNA targeting PAC (5′-TGTCGAGCCCGACGCGCGTG-3′) using Lipofectamine 2000 (Invitrogen). GFP positive cells were isolated by FACS two days after infection ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using Accutase or ReleSR (ThermoFisher Scientific).
-
bioRxiv - Cancer Biology 2023Quote: 5’ and 3’ RACE was performed using the GeneRacer kit (Thermo Fisher Scientific), following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... 200 nM MCPH1-5’-CUCUCUGUGUGAAGCACCUdTdT-3’) in serum-Free Opti-MEM medium (Gibco). The transfection controls were set up as above but without adding the siRNA oligos ...
-
bioRxiv - Microbiology 2024Quote: ... 5’-TATTGGTCTCAGGGAGCGAAAGCAGG 3’ using Superscript III according to the manufacturer’s protocol (Invitrogen, #18080400).68 PCRs were performed to amplify and append partial Illumina i5 and i7 adapter sequences across four sub-amplifications of each library to sequence the entire vRNA genome ...
-
bioRxiv - Cell Biology 2022Quote: ... For the bulk endocytosis experiments using the 4-[6-[4-(diethylamino)phenyl]-1,3,5-hexatrien-1-yl]-1-[3-(triethylammonio)propyl]-pyridiniumbromide dye (FM 4-64, Invitrogen), the cells were prepared as previously described [41] ...
-
bioRxiv - Genetics 2024Quote: ... and BSA (3%) for 4 hours at 4°C after which streptavidin-agarose UltraLink Resin (Thermo Fisher Scientific) for 1 hour at 4°C ...
-
bioRxiv - Bioengineering 2022Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was allowed to proceed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Biophysics 2022Quote: ... 19 mg EDC (1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide) (Thermo Fisher), 11 mg sulfo-NHS (N-Hydroxysulfosuccinimide ...
-
bioRxiv - Immunology 2022Quote: ... 1.9g of ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (ThermoFisher #22980) and 1.2g of N-hydroxysuccinimide (NHS ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % dipalmitoyl PI(3)phosphate (PI(3)P diC16) (Life Technologies) and extruded to 400 nm using a polycarbonate filter and a hand extruder (Avanti Polar Lipids ...
-
bioRxiv - Bioengineering 2023Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was performed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Bioengineering 2024Quote: ... and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, Thermo Scientific, 22980) were added to the alginate solution in a molar ratio of 1 alginate:30 NHS:25 EDC ...
-
bioRxiv - Biophysics 2024Quote: ... and 3-pyridinemethanol (RI = 1.545, 3-PM, A10381, Thermo Fisher Scientific) were used to mix with the water-based SMLM buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... human custom-made 3’UTR HEC1 siRNA (oligo #3, Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... Genomic PCR products obtained with primers 5’-CGCCATCAACTTCACCTAGC-3’ (forward) and 5’-TCTGGGAAGAAGTTTGGCCT-3’ (reverse) were sequenced using the BigDye® Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Massachusetts, USA) on an ABI 3130xl Genetic Analyzer (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... a probe prepared by PCR on genomic mouse DNA with the primers 5’-CATATTCCAGGTCCTTCAGTGTGC-3’ and 5’-CACTTTAGGACGTGAAAT ATGGCG-3’ was labeled with Cy3 by random priming according to the kit instruction (Invitrogen Kit, Ref 18095–011).
-
bioRxiv - Bioengineering 2021Quote: ... sgRNA LA93527 was generated from a PCR DNA template (overlapping primers LA935 5’-GAAATTAATACGACTCACTATAGGACAGTGCGGTCCG-CAAGGGTTTTAGAGCTAGAAA-3’ and LA137 5’-AAAAGCACCGACTCGGTGCCA-CTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3’) containing the T7 promoter using the MEGAscript T7 Transcription kit (ThermoFisher Scientific, Walthum, MA USA). The reaction mix was incubated at 37°C for 16 hours and purified using the MEGAclear Transcription Clean-Up kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were infected in a BSL-3 lab with the UF-1 strain of SARS-CoV-2 at MOI of 4 in media containing 3% low IgG FBS (Fisher Scientific, Cat. SH30070.03).