Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for 1R 2S 6R 7S 4 4 DIMETHYL 3 5 DIOXA 8 AZATRICYCLO 5.2.1.0 2 6 DECAN 9 ONE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... the Ca+2 indicator Fluo-4-AM (Molecular Probes, Eugene, OR; 2–5 µl of 2 mM dye) were dropped over S1 cortex ...
-
bioRxiv - Neuroscience 2022Quote: ... The final pellet was resuspended in 0.5 mL of NRB containing 6 μM 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher; D1306). The suspension was filtered through a 20 μm filter (Sysmex ...
-
bioRxiv - Neuroscience 2023Quote: FOs from 2 or 3 independent differentiations were fixed using 4% paraformaldehyde (Thermo Scientific) in PBS (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion) 5’-UGAUUAGUGAUUACCACUGCT-3’ RRM1 (On-Target plus SMARTpool – Dharmacon)
-
bioRxiv - Neuroscience 2024Quote: ... Medium was changed every 2-3 days and cells were passaged every 3-4 days using Versene (ThermoFisher) and medium supplemented with Y-27623 ROCK inhibitor (Tocris) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 7-Diethylamino-3-(4'-Maleimidylphenyl)-4-Methylcoumarin (CPM) was purchased from Thermo Scientific Life Technologies (Grand Island ...
-
bioRxiv - Biochemistry 2024Quote: ... as was 7- Diethylamino-3-(4’-Maleimidylphenyl)-4-Methylcoumarin (CPM) (Invitrogen™ D346) and CPM stock was prepared at 5 mg/mL ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4) Opal 620/anti-TdT (1:8, SEN28, Invitrogen), 5 ...
-
bioRxiv - Plant Biology 2023Quote: ... 4 or 8 μM of zeocin (Thermo Fisher Scientific) and grown for further 8 days in LD before fresh weight measurement ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Immunology 2024Quote: Two million splenocytes in 200 μl PBS from WT-Foxp3YFPCre/YFPCre and Dgka-/-zf/f-Foxp3YFPCre/YFPCre mice were seeded into a U-bottom 96-well plate in the presence or absence of 100 μM 2-(N-(7-Nitrobenz-2-oxa-1, 3-diazol-4-yl) Amino)-2-Deoxyglucose (2-NBDG; Life Technologies). After incubation at 37°C with 5% CO2 for 30min ...
-
bioRxiv - Biochemistry 2023Quote: ... NaHCO3 and 150 μL acetone containing 4 mg/mL 1-fluoro-2-4-dinitrophenyl-5-L-alanine amide (L-FDAA, Thermo Scientific) was added ...
-
bioRxiv - Bioengineering 2020Quote: ... We performed ERBB2 SNAPD on a 9:1 mixture of MOLT-4 and SK-BR-3 cells stained with CellTrace™ Calcein Red-Orange AM (Invitrogen). We then reinjected these droplets onto a dielectric sorting device (Fig ...
-
bioRxiv - Bioengineering 2022Quote: ... cells were rinsed in DPBS and incubated with 2 μg/ml DAPI (4′,6-diamidino-2-phenylindole, 62248; ThermoFisher) and 1:500 Alexa Fluor Plus 647 conjugated goat anti-rabbit secondary antibodies (A32733 ...
-
bioRxiv - Cell Biology 2022Quote: ... SDS-PAGE was performed using NuPAGE 4-12% Bis-Tris and 3-8% Tris-Acetate gels (Life Technologies). Nitrocellulose membranes were developed with horseradish peroxidase (HRP ...
-
bioRxiv - Biochemistry 2022Quote: ... and then analysed on Novex WedgeWell 4-12 % Tris-Glycine Gels or 3-8 % Tris-Acetate gels (Invitrogen). Tris-Glycine gels were run at 180 V for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... protein samples were resolved by SDS-PAGE on pre-cast NuPAGE™ gels (1.0 mm 4–12% Bis-Tris or 1.5 mm 3–8% Tris-Acetate for HMW TRIM37, Invitrogen) with molecular weight ladders (PageRuler Plus or HiMark pre-stained protein standard for HMW TRIM37 ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in glucose-free media containing 5 μg/ml 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher) and 2.5% FBS at 37 °C ...
-
Potassium channel-driven bioelectric signaling regulates metastasis in triple-negative breast cancerbioRxiv - Cancer Biology 2021Quote: ... CDH11 #4: 5’-CCUUAUGACUCCAUUCAAA-3’ using Lipofectamine RNAiMAX transfection reagent (13778030; ThermoFisher Scientific, Waltham, MA) in serum-free DMEM ...
-
bioRxiv - Immunology 2022Quote: ... cells were resuspended in PBS with 30nM of 4’,6-diamidino-2-phenylindole (DAPI, Life Technologies). In each tube ...
-
bioRxiv - Neuroscience 2021Quote: ... slices were incubated with 4’,6-diaminodino-2-phenylindole (DAPI, Life Technologies D-21490, 1:2000) for 15 min ...
-
bioRxiv - Neuroscience 2020Quote: ... The nuclear dye 4’,6-diamidino-2-phenylindole (DAPI) at 1 l ng/ml (Molecular Probes) was added to visualise all cells ...
-
bioRxiv - Physiology 2020Quote: ... Cell nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; 1:10,000; ThermoFisher, Table S13). Confocal images were acquired using an inverted laser scanning confocal microscope (Nikon Eclipse C1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and then the nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific) for 5 min ...
-
Single-cell protein analysis reveals metastable states during the transition to a sensory organ fatebioRxiv - Developmental Biology 2021Quote: ... Then they were stained with 0.5 μg/ml 4’,6-diamidino-2-phenylindole (DAPI, Thermo Scientific), and mounted in Vectashield (Vector Labs) ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were counterstained with 1/2500 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, ThermoFisher Scientific, USA). The cover slips were fixed in fluorescence mounting medium (Fluoromount-G ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were counterstained with 1/2500 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, ThermoFisher Scientific, USA). The cover slips were fixed in fluorescence mounting medium (Fluoromount-G ...
-
bioRxiv - Microbiology 2021Quote: ... and stained with 200 μl of 1.0 μg/ml 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen) diluted in PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... Nuclei were counterstained using 5μg/ml of DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride; D1306, Invitrogen) added during secondary antibody incubation.
-
bioRxiv - Cancer Biology 2021Quote: ... : DAPI Buffer (106mM MgCl2, 50 µg/mL 4’, 6-diamidino-2-phenylindole (DAPI, Invitrogen, Cat# D1306), 5mM Ethylenediaminetetraacetic acid (EDTA ...
-
bioRxiv - Physiology 2022Quote: ... CellTracker Green CMFDA Dye (C2925) and DAPI (4’,6-diamidino-2-phenylindole) (D1306) were from Invitrogen. EZ-Link Sulfo-NHS-LC-LC-Biotin (#21135 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Nuclei were then stained with 0.01% w/v 4’,6-diamidino-2-phenylindole dilactate (DAPI, Invitrogen) for 5 min and rinsed with ddH2O ...
-
bioRxiv - Neuroscience 2022Quote: ... Non-viable cells were excluded by staining with 4’,6-diamidino-2-phenylindole (Thermo Fisher, D1306). Flow-cytometric data were analyzed using FlowJo software (BD Biosciences).
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were counterstained with 300nM 4’,6-diamidino-2-phenylindole dilactate (DAPI) (D1306, ThermoFisher Scientific, UK) for imaging assessment (Zeiss Axio observer Z1 microscope) ...
-
bioRxiv - Immunology 2021Quote: ... Chamberslides were then incubated in 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI) (1:5,000, ThermoFisher Scientific) in 1x PBS for 5 min ...
-
bioRxiv - Immunology 2021Quote: ... however Live/Dead stain was not performed and instead 4’-6’-diamidino-2-phenylindole (DAPI, ThermoFisher) was added immediately prior to sorting for live/dead detection ...
-
bioRxiv - Neuroscience 2020Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) and Leica standard immersion oil were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... cell nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, Karlsruhe, Germany, 1:100) for 30 min at RT ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 4′6-diamidino-2-phenylindole (DAPI, nuclei staining, 1:10000; Cat. no. D1306, Life Technologies) diluted in PBS for 30 min at RT ...
-
bioRxiv - Cancer Biology 2022Quote: ... Slides then were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) or with YOYO-1 (ThermoFisher). When HPV probe signal co-localized with YOYO-1 signal detecting DNA at 63x magnification ...
-
bioRxiv - Bioengineering 2022Quote: ... counterstained with 1 μg/mL of 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific, #D1306) for 30 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nuclei were identified based on 4′,6-diamidino-2-phenylindole (DAPI; purchased from Thermo Fisher Scientific) staining before measurement of nuclear γH2AX and 53BP1 staining ...
-
bioRxiv - Microbiology 2022Quote: ... All stained sections were counterstained with 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen, cat. no. D1306) at a concentration of 1 μg/mL for 15 minutes at room temperature and mounted using ProLong Glass Antifade Mountant (ThermoFisher ...
-
bioRxiv - Physiology 2022Quote: ... Tissues were counterstained with the nuclear marker 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen Cat# D1306) at a dilution of 1:1000 in diluent (Agilent Cat# S0809 ...
-
bioRxiv - Neuroscience 2022Quote: ... Nuclear staining was done by 4’,6-diamidino-2-phenylindole (DAPI, catalog # D1306, Thermo Fisher Scientific). After several washes in 1xPBS ...
-
bioRxiv - Neuroscience 2022Quote: ... single nucleus suspensions were stained with DAPI (4’,6-diamidino-2-phenylindole dihydrochloride, ThermoFisher Scientific, D1306) at a concentration of 0.1μg/ml ...