Labshake search
Citations for Thermo Fisher :
5351 - 5400 of 10000+ citations for 6 Chloro 2 3 4 9 tetrahydro 1H pyrido 3 4 b indol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... a probe prepared by PCR on genomic mouse DNA with the primers 5’-CATATTCCAGGTCCTTCAGTGTGC-3’ and 5’-CACTTTAGGACGTGAAAT ATGGCG-3’ was labeled with Cy3 by random priming according to the kit instruction (Invitrogen Kit, Ref 18095–011).
-
bioRxiv - Neuroscience 2020Quote: Tissue sections from male (n = 3) and female (n = 3) rats were mounted on subbed glass slides (Fisher brand Superfrost Plus, Fisher Scientific, Hampton, NH, USA) and desiccated overnight (~16 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2019Quote: ... 9600 thermocycler using TAAR1 specific primers (Forward 5’ CCTGATTATGGATTTGGGAAAA 3’ Reverse 5’ TCATAAAGGTCAGTACCCCAGA 3’) using Amplitaq gold 360 (Applied Biosystems, Foster City, CA, USA). DNA sequencing was performed using ABI BigDye v3.1 cycle sequencing reagents and analyzed on an ABI 3130XL Genetic Analyzer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Red cells were removed by incubating the splenocytes for 3 minutes with 3 ml eBioscience™ 1X RBC Lysis Buffer (Invitrogen, ThermoFisher, #00-4333-57). Cells were pelleted by centrifugation ...
-
bioRxiv - Bioengineering 2021Quote: ... sgRNA LA93527 was generated from a PCR DNA template (overlapping primers LA935 5’-GAAATTAATACGACTCACTATAGGACAGTGCGGTCCG-CAAGGGTTTTAGAGCTAGAAA-3’ and LA137 5’-AAAAGCACCGACTCGGTGCCA-CTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3’) containing the T7 promoter using the MEGAscript T7 Transcription kit (ThermoFisher Scientific, Walthum, MA USA). The reaction mix was incubated at 37°C for 16 hours and purified using the MEGAclear Transcription Clean-Up kit (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: To generate the pMIR-REPORT-SRSF3-3’UTR-S construct containing the 3’UTR of SRSF3 at the 3’ end of luciferase ORF in the pMIR-REPORT™ vector (Invitrogen, Waltham, MA, USA), fragments were amplified using specific primers and human genomic DNA as a template and cloned in a sense orientation using a standard laboratory method (S5 Table) ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were resuspended to a density of ∼2.5 × 105 cells and allowed to attach for 3 h in 3 ml Nunc cell culture tubes #156758 (Thermo Fisher Scientific, Waltham, MA, USA) before exchanging the medium into encystation medium ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 4 μg/ml of blasticidin (ThermoFisher Scientific). HRAS RAS- less MEFs was cultured in 2.5 μg/ml of puromycin (ThermoFisher Scientific).
-
bioRxiv - Neuroscience 2020Quote: ... for 4 h and DAPI (Thermo Fisher Scientific) staining was used to visualize cytoarchitecture (1:5000 ...
-
bioRxiv - Immunology 2021Quote: ... and a Qubit™ 4 Fluorometer (Invitrogen Technologies). Separately labeled cDNA libraries were multiplexed according to the manufacturer’s protocol (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... run on 4-12% Bis-Tris gels (Invitrogen), and transferred to PVDF membranes ...
-
bioRxiv - Immunology 2022Quote: ... ELISA plates (Immulon 4 HBX, Thermo Fisher Scientific) were coated with PBS or 2 ug/mL recombinant protein and stored overnight at 4C ...
-
bioRxiv - Immunology 2022Quote: ... and quantified using a Qubit 4 Fluorometer (Invitrogen). The length distribution was determined via the TapeStation 4200 (Agilent Technologies ...
-
bioRxiv - Immunology 2020Quote: ... di-4-ANEPPDHQ (Thermo Fisher Scientific Cat# D36802). (iii ...
-
bioRxiv - Immunology 2019Quote: ... Cells were subsequently fixed in 4% paraformaldehyde (Affymetrix) and permeabilized by incubating for 5 min with PBS containing 0.02% NP-40 ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 µg/ml Gentamicin (1575-060, Gibco). Following recovery for 8-10 days ...
-
bioRxiv - Physiology 2020Quote: ... and a Qubit 4 Fluorometer (Thermo Fisher Scientific). RNA libraries were prepared using TruSeq® Stranded mRNA HT Sample Prep Kit (Illumina Inc. ...
-
bioRxiv - Plant Biology 2019Quote: Using a Vitrobot Mark 4 (FEI Thermo Fisher), 4 µL of mat3-4 cell culture was blotted onto R2/1 carbon-coated 200-mesh copper EM grids (Quantifoil Micro Tools ...
-
bioRxiv - Cancer Biology 2020Quote: ... Glypican 4 (Rabbit, PA5-97801; Thermo Fisher Scientific), antibodies specifically recogniz-ing the short and long isoforms of CD146 were previously described(Kebir et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 mM L-GlutaMax-I (ThermoFisher, catalogue #35050061), 10 µM Rho Kinase inhibitor Y-27632 (ROCKi ...
-
The tumour microenvironment shapes dendritic cell plasticity in a human organotypic melanoma culturebioRxiv - Immunology 2019Quote: ... L-glutamine (4 mmol/L; Life Technologies, Inc.), penicillin/streptomycin (50 IU/ml ...
-
The tumour microenvironment shapes dendritic cell plasticity in a human organotypic melanoma culturebioRxiv - Immunology 2019Quote: ... L-glutamine (4 mmol/L; Life Technologies, Inc.), penicillin/streptomycin (50 IU/ml ...
-
The tumour microenvironment shapes dendritic cell plasticity in a human organotypic melanoma culturebioRxiv - Immunology 2019Quote: ... L-glutamine (4 mmol/L; Life Technologies, Inc.), penicillin/streptomycin (50 IU/ml ...
-
bioRxiv - Immunology 2019Quote: Immulon 4 HBX microtiter plates (Thermo Scientific, USA) were coated with 50 µl/well of 5 µg/ml diphtheria toxoid ...
-
bioRxiv - Developmental Biology 2020Quote: ... fixed with 4% paraformaldehyde (Cat#15710, Fisher scientific) overnight at 4°C ...
-
bioRxiv - Systems Biology 2020Quote: ... Biotin-CD31 (4 µL; Invitrogen MHCD31154, clone MBC78.2), Biotin-CD45 (1 µL ...
-
bioRxiv - Cancer Biology 2020Quote: Samples were fixed with 4% paraformaldehyde (Thermofisher Scientific) solution for 10 min and permeabilized with 0.2% Triton X-100 for 5 min ...
-
bioRxiv - Genomics 2021Quote: ... Cells were fixed in 4% paraformaldehyde (ThermoFisher 28906) for 15 m ...
-
bioRxiv - Neuroscience 2021Quote: ... or Fluo-4 (200 μM, Thermo Fisher, F14200) via patch electrode ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.2 mM Fluo-4 pentapotassium salt (Life Technologies), adjusted to pH 7.2 with KOH ...
-
bioRxiv - Biophysics 2020Quote: ... 4 -Chlorobenzenesulfonate Salt) (DiD) were purchased from ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... with 20% methanol (Fisher Scientific, Cat #A412P-4). Protein was transferred onto PVDF paper (Millipore Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... Using a Vitrobot Mark 4 (FEI Thermo Fisher), 4 μL of cell culture (mid-log phase ...
-
bioRxiv - Cell Biology 2020Quote: ... 4) blocked with 10% Goat serum (ThermoFisher Scientific) and 1% bovine serum albumin (Sigma ...
-
bioRxiv - Systems Biology 2020Quote: ... 4 μL 5x Phusion HF Buffer (Thermo Scientific), 4 μL 5M Betaine (Sigma-Aldrich) ...
-
bioRxiv - Genetics 2020Quote: ... 4 µl collagenase I (#17018-029 Life Technologies)) was equilibrated to 37°C and then 75 µl were added to each of the wells in the cassette ...
-
bioRxiv - Microbiology 2021Quote: ... and 4 ml 7.5% sodium bicarbonate (7.5%, Gibco), and adjusted to pH 7.4 ± 0.2 using 1M HCl.
-
bioRxiv - Immunology 2021Quote: ... supplemented with 4 mM of L-glutamine (Gibco). Both Vero cell lines were cultured at 37 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... using a CytoSpin 4 Centrifuge (Thermo Fisher Scientific). Nuclei were fixed in 4% PFA for 5 minutes ...
-
bioRxiv - Plant Biology 2020Quote: ... Roots were fixed in 4% paraformaldehyde (Acros organics) in PBS (Alfa Aesar ...
-
bioRxiv - Molecular Biology 2020Quote: ... resuspended in 4 mL of sterile PBS (Gibco). RNA extraction and cDNA production were performed using the commercial RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: ... for 20 msec and 4 pulses (ThermoFisher Scientific), according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and quantified using a QuBit 4 Fluorometer (Invitrogen). Samples sequenced on a Miniseq (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... samples were fixed with 4% paraformaldehyde (Affymetrix; #19943) for 7 min at room temperature and permeabilized with iced-cold methanol ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were fixed with 4% formaldehyde (Thermo Scientific) for 15 min or ice-cold methanol for 5min ...
-
bioRxiv - Cell Biology 2021Quote: ... fractions were analyzed by 4–12% NuPAGE (Invitrogen) and the U4 ...
-
bioRxiv - Cell Biology 2022Quote: ... and 4% acrylamide (AA, 40% stock solution, Invitrogen) in PBS and incubated for four to five hours at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... Human BMP-4 Recombinant Protein (Gibco, Catalog # PHC9534). For cell culture of iPSCs on niches ...