Labshake search
Citations for Thermo Fisher :
5251 - 5300 of 10000+ citations for TRAP 5 amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and used in a 50μl transcription reaction containing 5 x transcription buffer (ThermoFisher), 8mM rNTPs ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5-(and-6)-chloromethyl-2′,7′ dicholorodihydrofluorescein diacetate (CM-H2DCFDA; Molecular Probes C6827), was used to visualize ROS accumulation (excitation ...
-
bioRxiv - Immunology 2022Quote: 5 × 106 MC/9 cells were suspended in 0.5 ml of optiMEM (GIBCO) and kept at room temperature for 10 min ...
-
bioRxiv - Immunology 2022Quote: ... 5×106 MC/9 cells were suspended in 0.5 ml of optiMEM (GIBCO) and kept at room temperature for 10min before electroporation was performed as stated above.
-
bioRxiv - Immunology 2022Quote: ... or 2.5μM of 5-(and-6)-Carboxy-2’,7’-Dichlorofluorescein Diacetate (DCFDA) (Invitrogen) was then added and incubated with the cells 20 minutes at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... and H1-G2E1-5 was detected by mouse anti-His6-tag antibody (Invitrogen) and subsequently by HRP-conjugated secondary antibody (Jackson ImmunoResearch) ...
-
bioRxiv - Genomics 2022Quote: ... The erythrocytes were lysed using 5 mL ACK lysing buffer (Gibco, Shanghai, China). Dead cells were removed with a Dead Cell Removal Kit (Miltenyi ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 × 106 cells were stained with 5 µM MitoSOX (Molecular Probes, Thermo Fisher) in PBS at 37°C for 40 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 × 106 cells were stained with 5 µM MitoSOX (Molecular Probes, Thermo Fisher) in PBS at 37°C for 40 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5-10 μg of protein were boiled in NuPAGE LDS sample buffer (Invitrogen) at 95°C for 5 min and separated using NuPAGE 4%–12% Bis-Tris Protein Gel (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by blocking for 2 hours in 5% goat serum (Invitrogen, Waltham, MA) in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... or a control mimic at 5 nM final concentration using Opti-MEM (Gibco) and Lipofectamine RNAiMax Transfection reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... Real-time qPCR was performed using QuantStudio 5 Real-Time PCR System (ThermoFisher) and PowerUp SYBR™ green master mix ...
-
bioRxiv - Neuroscience 2021Quote: Samples from 5-month-old SNR-derived organoids were homogenized in Trizol (Invitrogen), and total RNA was purified using the RNeasy Micro Kit (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... and were loaded together with 5 μL of loading buffer (Invitrogen, Germany, EU) into a 12% polyacrylamide gel.
-
bioRxiv - Neuroscience 2020Quote: ... The tissue was dissociated into cells in DMEM containing 5% FBS (Gibco, 1008214) and 1% Penicillin/Streptomycin (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... HIOs were cultured in groups of 5/well using 4-well plates (ThermoFisher). Individual HIO lumens were microinjected using a glass caliber needle with 1μl of PBS control or different STm mutants (105CFU/HIO or 103CFU/HIO for 24h infections) ...
-
bioRxiv - Microbiology 2020Quote: ... and reactions performed on the QuantStudio 5 Real-Time PCR systems (Thermo Fisher). Host gene expression was determined using the 2-ΔΔCt method and normalised to GAPDH expression ...
-
bioRxiv - Cancer Biology 2020Quote: ... OSI-027 (5 μM, 10 μM, 25 μM, and 100 μM) (Fisher Scientific), and Everolimus (2 nM ...
-
bioRxiv - Immunology 2021Quote: ... for 20 min or 5 µM MitoSOX™ Red mitochondrial superoxide indicator (Invitrogen) for 10 min at 37 °C according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... iMD3 cells were growth in 5%KSR medium (Alpha-MEM (12571-063, Gibco); 5% KSR (10828028 ...
-
bioRxiv - Molecular Biology 2020Quote: 5 × 15cm plates of HEK293 Flp-In T-REx cells (ThermoFisher Scientific, R78007) at 80% confluency were harvested in 15mL DMEM media by trypsinization ...
-
bioRxiv - Microbiology 2021Quote: ... in a humidified incubator supplemented with 5% CO2 at 37°C (Thermo Scientific). HepAD38 cells were cultured as previously described26 ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were stained with the DNA-binding dye Hoechst (5 μg/ml; Invitrogen), and coverslips were mounted in mounting medium (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies: Claudin-5 (mouse, clone 4C3C2, ThermoFisher cat# 35-2500, 1:100), Iba1 (goat polyclonal ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by a short 5 min incubation in a DAPI solution (Molecular Probes). A 5 min incubation in 1% Sudan Black B prepared in 70% ethanol was applied to quench autofluorescence ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5% CO2 and passaged twice a week using Trypsin-EDTA (0.25%) (Life Technologies). Cells were tested for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza) ...
-
bioRxiv - Neuroscience 2021Quote: ... The precipitants were washed 5-times using DynaMag-2 (Thermo Fisher Scientific, 12321D) and subjected to reverse transcription for quantitative real time PCR to quantify relative levels of CSDE1-associated Gpr151 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were stained for DAPI (Thermo Fisher R37606, 5 min at room temperature) before mounting coverslips on slides in Fluoromount (Sigma F4680 ...
-
bioRxiv - Neuroscience 2021Quote: ... either filled with 5 µl of 10% Fluoro-Ruby (Invitrogen, Carlsbad, CA, USA) or 5 µl of 2% Fast-Blue (Polysciences ...
-
bioRxiv - Immunology 2020Quote: ... first with 2 mM disuccinimidyl glutarate (ThermoFisher Scientific, 20593, CAS: 79642-50-5) for 30 minutes at RT ...
-
bioRxiv - Biochemistry 2021Quote: ... and 5-aminolevulinic acid hydrochloride were purchased from Acros Organics (Fair Lawn, NJ). The 11-hydroxylauric and 12-hydroxylauric-d20 acid standards were purchased from Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2021Quote: ... incubated in medium containing 20 mM EdU (5-ethynyl-2-deoxyuridine, Life Technologies) for the final 30 min and then washed with PBS and fixed with 4% paraformaldehyde (PFA ...
-
bioRxiv - Biochemistry 2020Quote: ... The flow cell was incubated with 5 μg/ml of Neutravidin (Molecular probes) in RB for 2 min ...
-
bioRxiv - Microbiology 2021Quote: ... livers were mechanically disrupted in 5 mL DMEM medium (Thermo Fisher scientific, USA) containing liver dissociation enzymes ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were maintained at 37 °C in 5% CO2 in Neurobasal Medium (Gibco) supplemented with 1x B27 and 1x Glutamax ...
-
bioRxiv - Cancer Biology 2021Quote: ... The samples were resolved on a 5-15% Bis-Tris gel (Thermo Fisher) followed by blotting ...
-
bioRxiv - Microbiology 2021Quote: ... (5) washed extensively and incubated with highly cross-absorbed anti-rabbit Alexa568 (ThermoFisher), anti-chicken IgY FITC (Life Technologies) ...
-
bioRxiv - Immunology 2022Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP, Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative RT-PCR was performed using Quantstudio 5 (Thermo Fisher Scientific, Berlin, Germany) and GoTag®qPCR Master Mix with SYBR green fluorescence (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: NK cells were treated with 5 μM CellTrace CFSE (Invitrogen, cat no. C34554A) in RMPI media+ 5% FBS for 5 minutes ...
-
Cardiac fibroblasts regulate cardiomyocyte hypertrophy through dynamic regulation of type I collagenbioRxiv - Cell Biology 2022Quote: ... Wheat germ agglutinin (488) was from ThermoFisher (W11261; 5 µg/ml for IF).
-
bioRxiv - Biochemistry 2022Quote: ... a 1 ml click reaction containing 5 μl 1 mM Azide-488 (Invitrogen), 100 μl 20 mg/ml sodium ascorbate ...
-
bioRxiv - Immunology 2019Quote: ... adherent cells were cultured at 37°C with 5% CO2 in DMEM (GIBCO) plus 10% heat-inactivated FCS with penicillin ...
-
bioRxiv - Plant Biology 2019Quote: ... truncatula roots were inoculated with 5 μ of FM4-64 (Invitrogen, Molecular Probes) diluted from 5 mM stock in water to stain the endocytic organelles ...
-
bioRxiv - Plant Biology 2019Quote: ... truncatula roots were inoculated with 5 μ of FM4-64 (Invitrogen, Molecular Probes) diluted from 5 mM stock in water to stain the endocytic organelles ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.125 IU/mL Insulin (Novo Nordisk) and 5 ng/mL mEGF (Life Technologies). The human mammary epithelial cell line PMC42 was a gift from Professor Leigh Ackland (Deakin University ...
-
bioRxiv - Immunology 2019Quote: ... mice were injected with 100µg 5-Ethynyl-2′-deoxyuridine (EdU) i.p (Invitrogen, USA) and euthanized 4 hours later ...
-
bioRxiv - Developmental Biology 2019Quote: ... Embryo sections 5 μm thick were cut (Microm HM 335E; Thermo Fisher Scientific) and placed on glass slides (Matsunami Glass Ind. ...