Labshake search
Citations for Thermo Fisher :
5051 - 5100 of 10000+ citations for 6 Chloro 2 3 4 9 tetrahydro 1H pyrido 3 4 b indol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... loaded with 2-4 μM Fluo-5N and incubated with 200 nM MitoTracker® Red CMXRos – M7512 (Invitrogen, USA). To load Fluo-5N ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mesenteries were then stored for up to 48hrs at 4°C into PBS with 2% Antibiotic-Antimycotic solution (ThermoFisher).
-
bioRxiv - Bioengineering 2022Quote: ... glacial acetic acid) for 2 hours at room temperature (Section 2.14) or methanol-free 4% formaldehyde (ThermoFisher, Section 2.16) and then kept in PBS at 4°C before washing in gradations of ethanol up to 100% ...
-
bioRxiv - Microbiology 2020Quote: ... were quantified using an avidin and 4’-hydroxyazobenzene-2-carbocylic acid assay according to the manufacturer’s instructions (Fisher Scientific). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: ... Ni-NTA His.Bind® Resin (2-4 ml) was packed into a 10 ml Pierce disposable column (Thermo Fisher) and connected to the peristaltic pump ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Homogenised leaf tissues were centrifuged at 18,000 g 10 min 4 °C and 2 μL supernatant mixed with 48 μL Bradford reagent (ThermoFisher Scientific ...
-
bioRxiv - Biophysics 2020Quote: ... Grids were blotted for 4 seconds at -2 force and vitrified in liquid ethane using a MarkIV Vitrobot (ThermoFisher). The blotting chamber was maintained at 22°C and 100% humidity during freezing.
-
bioRxiv - Microbiology 2019Quote: ... After 4 washes with PBS 0.01% v/v Tween-20 and 2 washes with ELISA Light washing buffer (ThermoFisher), CSPD substrate with Sapphire II enhancer (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... The immunoprecipitates were dissolved in 2×SDS loading buffer and resolved on NuPAGE 4–12% Bis-Tris gel (Invitrogen), and then silver stained using Pierce silver stain kit (Thermo) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tissues were immersed in 2ml dissociation solution (2% FCS-PBS solution with approximate 145U/ml type 4 Gibco collagenase) and incubated at 37°C for 30 minutes ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μL of capture Ab (~4 μg/ml) or SARS-CoV-2 recombinant antigen (~0.2 mg/ml) in 1x PBS (Gibco) was loaded in each channel ...
-
bioRxiv - Developmental Biology 2022Quote: ... for 2 hours at 250mA and 4°C using cold transfer buffer (1.5x NuPAGE transfer buffer (Thermo Fisher Scientific), 10% methanol ...
-
bioRxiv - Cell Biology 2022Quote: ... or 2-well and 4-well chamber slides were transiently transfected with various cDNA constructs using Lipofectamine 2000 (Invitrogen) or FuGENE 6 (Promega ...
-
bioRxiv - Immunology 2022Quote: ... Cells then were washed twice with FACS buffer and stained for 5 minutes at 4°C with 0.5 mg/mL of 40,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher). PE and DAPI staining were measured with an iQue Screener Plus flow cytometer (Intellicyt ...
-
bioRxiv - Microbiology 2022Quote: ... PCDH1 variants (sEC1-2 and sEC1-4) were generated by cloning the following sequences into the pcDNA3.1 mammalian expression vector (ThermoFisher): EC1-EC2 (residues 1-284 ...
-
bioRxiv - Neuroscience 2023Quote: ... and concentrated by centrifugation at 85,000x g for 2 hours at 4°C in a Sorvall WX 100 Ultra Ultracentrifuge (ThermoFisher). The supernatant was discarded and viral pellet resuspended in a volume of PBS containing calcium and magnesium (#14090-055 ...
-
The logic of native enhancer-promoter compatibility and cell-type-specific gene expression variationbioRxiv - Genomics 2022Quote: ... All cell lines were passaged regularly (every 2 to 4 days) with Accutase (PAA) or TrypLE (Thermo Fisher Scientific), and ESCs and EpiSCs were occasionally selected for Oct4 expression with 1µg/ml puromycin (Sigma) ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 µL RNase A/T1 Mix (4 µg RNase A, 10 U RNase T1, ThermoFisher Scientific, MA, USA) at 37°C for 30 min to remove host-originating nucleic acids ...
-
bioRxiv - Molecular Biology 2023Quote: ... and MUTYH KO cells were obtained by infection of BJ FAP-TRF1 WT with lentivirus expressing respectively guide RNAs targeting OGG1 exon 4 (gRNA3, sequence GCTACGAGAGTCCTCATATG) and MUTYH exon 2 (gRNA5, sequence GCATGCTAAGAACAACAGTC) and selected with 1.5 µg/ml Puromycin (Gibco). OGG1 KO/MUTYH KO (DKO ...
-
bioRxiv - Microbiology 2023Quote: ... The obtained cDNA was diluted to 2-4 ng/µl for subsequent qPCR with the Sybr Green (Applied Biosystems) method ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were stored in 2% PFA at 4°C prior to analysis using an Attune NxT Flow Cytometer (Invitrogen) in the Flow Cytometry Core Facility of the Faculty of Medicine & Dentistry at the University of Alberta ...
-
bioRxiv - Microbiology 2023Quote: ... (BEI NR-52310) or pSARS2-SΔCT and 4 μg pTRMPSS2 (VRC/NIAID) diluted in 2 mL OPTIMEM media (Gibco) (DNA OPTIMEM mixture) ...
-
bioRxiv - Microbiology 2023Quote: ... 2 ug of EV protein content were separated on a 4-12% Bis-Tris gel (Thermo Scientific, Rockford, IL), then blotted onto a PVDF membrane ...
-
Entorhinal cortex vulnerability to human APP expression promotes hyperexcitability and tau pathologybioRxiv - Neuroscience 2024Quote: ... 2/3rd of the eluted protein samples were resolved on a 4–12% Bris-Tris gel (Invitrogen: cat# NW04125box) and subjected to Silverstein (Pierce™ Silver Stain Kit ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... into the packaging 293T cells (with molar ratio for Luc-T20: N: M/E: S as 3: 1: 1: 1) with LipofectamineTM 2000 (Thermo Fisher Scientific). At 24 and 48 hours post-transfection ...
-
bioRxiv - Microbiology 2023Quote: ... coli DH5α or One Shot® ccdB SurvivalTM 2 T1R (Invitrogen) for plasmids containing the ccdB containing Gateway cassette were used.
-
bioRxiv - Neuroscience 2024Quote: ... with 2% heat-inactivated FBS Certified One Shot (Gibco, A38400-01) and 1x N-2 supplement (Gibco ...
-
bioRxiv - Cell Biology 2019Quote: ... 2,7-Dichlorodihydrofluorescein diacetate (DCFH-DA),3,3’-dihexyloxacarbocyanine iodide [DiOC6(3)] and N-[4-[6-[(acetyloxy)methoxy]-2,7-difluoro-3-oxo-3H-xanthen-9-yl]-2-[2-[2-[bis[2-[(acetyloxy)methoxy]-2-oxoethyl]amino]-5-methylphenoxy]ethoxy]phenyl]-N-[2-[(acetyloxy)methoxy]-2-oxoethyl]-,(acetyloxy)methyl ester (Fluo-4 AM) were purchased from Molecular Probes (Invitrogen, Eugene, OR, USA). Agarose was obtained from Lonza (Walkersville ...
-
bioRxiv - Cell Biology 2019Quote: ... methoxy]-2-oxyethyl] amino]-5-methyl-phenoxy] ethoxy]phenyl-N-[2-[(acetyloxy) methoxy]-2-oxyethyl]-(acetyloxy) methyl ester (Fluo-4/AM) were from Molecular Probes (Invitrogen, Eugene, OR, USA). M ...
-
bioRxiv - Molecular Biology 2019Quote: ... Antibody-bound chromatin was captured with magnetic beads for 1 h at 4°C (50 μl 1:1 mixture of Dynabeads Protein A and Dynabeads Protein G, Invitrogen). DNA from both input and ChIP samples was then extracted using phenol/chloroform ...
-
bioRxiv - Molecular Biology 2021Quote: ... The probe was biotin labeled at the 3’ end using a Pierce™ Biotin 3’ End DNA Labeling Kit (Thermo Fisher Scientific Inc.). Seven micrograms of nuclear protein were added to a binding reaction mixture containing 2µl 10X binding buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... oligonucleotide duplexes were designed against TG2 (sense, 5’-AAGGGCGAACCACCTGAACAA-3’ and antisense, 5’-TTGTTCAGGTGGTTCGCCCTT-3’) and TOPOIIα siRNA (purchased from Thermo Fisher, Catalog # AM16708). Plasmids and miRNA were transfected with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Microbiology 2020Quote: Vero E6 and Calu-3 cells (Calu-3:ATCC HTB-55; Vero E6: ATCC, CRL-1586) were maintained in high glucose DMEM (Gibco, Waltham, MA, USA) supplemented with 10% FBS (R&D Systems ...
-
bioRxiv - Cancer Biology 2020Quote: Apoptosis was measured by caspase-3/7 staining using CellEvent® Caspase-3/7 Green ReadyProbes® Reagent (ThermoFisher Scientific Inc., cat# R37111). CHLA20 and NGP cells were grown until confluence on 6-well plates with six days of treatment with DMSO or GSK591 ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... A recombinant lentivirus vector expressing the coding sequence of the EBV transactivator BZLF1 under control of a tetracycline-regulated promoter was constructed by cloning the open reading frame amplified with the primers 5’-CGACCGGTATGATGGACCCAAACTCGAC-3’ and 5’-CGACGCGTTTAGAAATTTAA GAGATCCTCGTGT-3’ into the Age I and Mlu I sites of the pTRIPZ lentiviral vector (Thermo Fisher Scientific, USA). For virus production ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135; 10 kD BDA Invitrogen D1956; diluted in 0.9% NaCl) were used as retrograde and anterograde tracers ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 ng/mL (n = 3) and 10 ng/mL (n = 3) treatment were subjected to albumin depletion according to the manufacturer’s instructions (Thermo Fisher Scientific, Loughborough, UK). Individual samples were digested with trypsin (2.5µg trypsin ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 48hrs after transfection the cells were fixed and stained for activated Caspase-3/7 using Apoptosis CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) according to manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Cancer Biology 2021Quote: ... each sample was injected onto an EASY-Spray PepMap C18 column (75 mm id 3 25 cm, 2 mm particle size) (Thermo Scientific) and separated over a 2-h method ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were injected and concentrated on a trap column (PepMap100 C18, 3 µm, 100 Å, 75 µm i.d. x 2 cm, Thermo Scientific) equilibrated with 0.05% TFA ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peptides were injected onto an Acclaim PepMap100 C18 trap column (75 μm i.d., 2 cm long, 3 μm, 100 Å, Thermo Scientific) and further separated on an Acclaim PepMap100 C18 analytical column (75 μm i.d. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peptide mixtures were loaded on a C18 Acclaim PepMap100 trap-column (75 μm ID x 2 cm, 3 μm, 100Å, ThermoFisher Scientific) for 3.5 minutes at 5 μL/min with 2% ACN (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... 2-3 ml of logarithmically growing yeast cells in DOA media were added to a 35 mm FluoroDish (Fisher Scientific; 15199112) which had been pre-incubated at 30°C with Concanavalin A (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: Bone marrow was obtained from 2-3-month-old mice and cultured with 100 ng/ml of M-CSF (Prospec Bio) in αMEM (Gibco Invitrogen) supplemented with 10% FCS for three days ...