Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for Transcription Factor SOX 10 SOX10 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Epidermal Growth Factor protein (Gibco, USA). All the cell lines were grown at 37°C in a humidified chamber with 5% CO2 and authenticated by STR profiling.
-
bioRxiv - Neuroscience 2023Quote: ... and fibroblast growth factor (FGF) (Gibco). Expanded rOPCs were seeded in 96-well AA plates at a density of 20,000 cells per well in differentiation medium ...
-
bioRxiv - Biochemistry 2023Quote: ... von Willebrand factor (Invitrogen, RP-43132), transferrin (R&D systems ...
-
bioRxiv - Biochemistry 2023Quote: ... Coagulation factor XII (Invitrogen, RP-43076), von Willebrand factor (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... expressing reprogramming factors (CytoTune, Life Technologies). All reprogramming and assessment of pluripotency was performed by Sampled ...
-
bioRxiv - Cell Biology 2020Quote: ... and sorted into Ham’s F-10 plating medium (Cellgro) supplemented with 5 ng/mL basic fibroblast growth factor (Invitrogen), 10% FBS (Invitrogen) ...
-
bioRxiv - Developmental Biology 2021Quote: ... in vitro transcription (mMESSAGE mMACHINE T3 Transcription Kit, Life Technologies) and product purification ...
-
bioRxiv - Immunology 2022Quote: ... reverse transcription (High-Capacity cDNA Reverse Transcription Kit, ThermoFisher Scientific), and quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Physiology 2023Quote: Transcription Kit (Invitrogen). The qPCR was performed in a QuantStudio 6 Flex Real-Time PCR System (Life Technologies) ...
-
bioRxiv - Neuroscience 2020Quote: ... Tissue sections were first immuno-stained for SOX10 and then reacted for EdU using the Click iT® EdU Alexa Fluor ® 488 Imaging kit (Invitrogen). After 20 minutes slides were washed in PBS and mounted.
-
bioRxiv - Biochemistry 2020Quote: ... followed transcription with the mMESSAGE mMACHINE SP6 transcription kit (Invitrogen AM1344). Synthesized mRNA was quantified using a Nanodrop 1000 ...
-
bioRxiv - Plant Biology 2022Quote: ... Reverse transcription was performed with Reverse Transcription SuperScript™ IV (Invitrogen) in presence of hexamers and oligo dT primer (Michaud et al. ...
-
bioRxiv - Immunology 2021Quote: ... Reverse transcription was performed with TaqMan reverse transcription reagents (Life Technologies). Real-time PCR was performed using Fast SYBR™ Green Master Mix (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: ... during in vitro transcription using MEGAscript T7 Transcription Kit (Invitrogen, AM1334). RNA was run on 6% polyacrylamide gel and stained with 0.1% toluidine blue to assess RNA integrity.
-
bioRxiv - Molecular Biology 2022Quote: ... then applying 2 ml of 10% trypsin-EDTA and re-plated on T75 flasks coated with attachment factor (S-006-100, Gibco). In vitro formation of capillary-like structures was performed on growth factor–reduced Matrigel (356231 ...
-
bioRxiv - Bioengineering 2019Quote: ... or human organoid basal culture media consisting of conditioned media produced using stably transfected L cells (Wnt 50%; R-spondin 10%; Noggin 5%) and the following growth factors: B12 1X (Invitrogen), Nicotinamide 10mM (Sigma-Aldrich) ...
-
bioRxiv - Systems Biology 2021Quote: ... Samples were diluted with a factor 1/10 with distilled water then DNA content was measured with the Qubit 3.0 fluorometer (Life Technologies). Qubit dsDNA HS (high sensitivity ...
-
bioRxiv - Immunology 2022Quote: ... 2×107 murine bone marrow progenitors were seeded in 100 ml RPMI-FBS supplemented with 10% J558-conditioned medium containing Granulocyte-Macrophage Colony-Stimulating Factor (GM-CSF) in 500 cm2 square petri dishes (Nunc). Cells were incubated at 37°C in 5% CO2 ...
-
bioRxiv - Biophysics 2022Quote: ... with a dilution factor of 8 × 10-8 and yellow-green (505/515) 40 nm fluorescent beads (F10720, Thermo Fisher) with a dilution factor of 8 × 10-6 in PBS and allowing them to deposit on a coverslip.
-
bioRxiv - Cell Biology 2023Quote: ... E8 supplement ThermoFisher-A1517001) on tissue-culture dishes coated with 10 µg/cm2 of reduced Growth Factor Basement Membrane matrix (Geltrex, ThermoFisher A1413202 resuspended in basal medium DMEM/F12 Thermo Fisher 21331020) ...
-
bioRxiv - Cell Biology 2023Quote: Pooled HUVEC sample sets were grown to confluence before treatment with or without recombinant tumour necrosis factor alpha (TNF; 10 ng/mL) (ThermoFisher) in cell culture medium ...
-
bioRxiv - Neuroscience 2024Quote: ... 450-02), 20ng/ml Glial cell line-derived neurotrophic factor (GDNF) (PreproTech, 450-10) and 5μg/ml laminin (Invitrogen, 23017015) added weekly into the medium.
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoprecipitation of endogenous PRRC2B was performed using 1 μg (dilution factor 1:125) rabbit anti-human PRRC2B antibody (Invitrogen) followed by Magnetic dynabead protein A (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... The whole 10 µl of the RNA elute was used for reverse transcription with Superscript III (Invitrogen) using the recommended reaction supplemented with 0.5 μl of RiboLock RNase Inhibitor (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... A total of 10 µg of RNA was reverse-transcribed using Superscript IV Reverse-Transcription kit (Invitrogen) using an hTERT specific probe in exon-4 (CCTGACCTCTGCTTCCGACAG) ...
-
bioRxiv - Genomics 2021Quote: ... 100 nL of reverse transcription mix (1× First Strand Buffer and 10 mM DTT (Invitrogen, 18064-014), 2 U RNaseOUT Recombinant Ribonuclease Inhibitor (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: ... Samples were incubated at room temperature for 10 min reverse transcription using SuperScript III Reverse Transcriptase (Invitrogen) with the following reaction mix ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total mRNA (10 μg) was used for reverse transcription with SuperScript IV Reverse Transcriptase (Thermo Fisher Scientific) in 100 uM DTT ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 ng of total RNA were reverse transcribed using a TaqMan MicroRNA Reverse Transcription Kit (ThermoFisher Scientific) and RT specific primers for miRNAs (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... & Growth Factors (Thermo Fisher, USA, Cat# CC3150). In vitro all cells were grown at 37°C with 5% CO2 ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with human epidermal growth factor (Gibco) (2.5 ng/mL) ...
-
bioRxiv - Neuroscience 2022Quote: ... and epidermal growth factor (Invitrogen, 53303-018) (Henderson et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... supplemented with epidermal growth factor (EGF, Thermofisher), fibroblast growth factor (FGF ...
-
bioRxiv - Neuroscience 2022Quote: ... Reduced Growth Factor Basement Membrane Matrix (Gibco) coated 6-well plates in Essential 8 medium (Gibco ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... or human epithelial growth factor (EGF, Gibco) and 300 μg/l bovine pituitary extract (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2020Quote: ... human insulin-like growth factor (Life Technologies), penicillin/streptomycin (Gibco) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10ng/ml human stem cell factor (Invitrogen) and 10 nM endothelin-1 (Bachem) ...
-
bioRxiv - Pathology 2019Quote: ... 0.2ng/ml epidermal growth factor (Gibco, UK), 25µg/ml G418 sulphate (VWR Life Science ...
-
bioRxiv - Cancer Biology 2021Quote: ... fibroblast growth factor (FGF; #PHG0021, Life Technologies part from ThermoFisherScientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Macrophage colony-stimulating factor (M-CSF; Invitrogen) was added at a concentration of 20 ⎧g/ml to facilitate differentiation of the bone marrow cells into macrophages (7–10 days).
-
bioRxiv - Cancer Biology 2021Quote: ... epidermal growth factor (EGF; #PHG0311, Life Technologies, part of ThermoFisherScientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 ng/ml hepatocyte growth factor (Invitrogen), 0.1 μmol/l dexamethasone (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: ... or growth factor reduced Geltrex (Gibco, A1413202) and dispensed as gel domes in 24-well tissue culture plates ...
-
bioRxiv - Neuroscience 2023Quote: ... Interferon Regulatory Factor 8 (IRF8, Thermo Fisher Scientific Cat# 12-9852-82 ...
-
bioRxiv - Neuroscience 2023Quote: ... and Ciliary Neurotrophic factor (CNTF, Gibco: PHC7015) were prepared in ultrapure sterile water and added to a final concentration of 20 ng/ml each to the organoid culture media comprising Neurobasal (-A ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription was performed using high-capacity reverse transcription kit (Applied Biosystems) per the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reverse transcription was performed using high-capacity reverse transcription kit (Applied Biosystems) per the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... the transcription reactions were performed using T7 in vitro transcription system (Ambion) in presence of [32P] UTP and riboprobes obtained were used in binding experiments with M14 and B-LCL#5 S100 extract ...
-
bioRxiv - Developmental Biology 2021Quote: ... In vitro transcription was performed using mMachine SP6 Transcription Kit (Invitrogen #AM1340) following the manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by in vitro transcription using MEGAscript T7 Transcription Kit (Thermo Fisher), according to the manufacturer’s instructions ...