Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for Estrone 3 Glucuronide E1G ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... RdRp_rev 5’-CAAATGTTAAAAACACTATTAGCATA-3’ RdRp_probe 5’-FAM-CAGGTGGAACCTCATCAGGAGATGC-TAMRA-3’) and/or TaqMan gene expression assays (Applied Biosystems) for ACTB (Hs99999903_m1) ...
-
bioRxiv - Immunology 2022Quote: ... and their corresponding FAM-labelled MGB probes (εGLT: 5′-AGGCACCAAATG-3′ and γ1GLT: 5 ′-CTCAGCCAGGACCAAG-3′) (Applied Biosystems) were designed in house ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’- CCACCCTCCAGCCAATC-3’ and FAM/ZEN-labeled probe 5’-ACAGGGCAACCATTGGCTCG-3’ with Taqman Gene Expression Master Mix (ThermoFisher).
-
bioRxiv - Cell Biology 2023Quote: ... siRNA targeting topoisomerase 2beta (5’CGAUUAAGUUAUUACGGUUtt 3’, s106; 5’ GAGUGUACACUGAUAUUAAtt 3’, s108; both purchased at Ambion/ThermoFIsher Scientific), TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA targeting topoisomerase 2beta (5’CGAUUAAGUUAUUACGGUUtt 3’, s106; 5’ GAGUGUACACUGAUAUUAAtt 3’, s108; both purchased at Ambion/ThermoFIsher Scientific), TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’ ...
-
bioRxiv - Microbiology 2023Quote: The embB region containing codon 406 was amplified using PCR primers F1 5’-TGATATTCGGCTTCCTGCTC-3’ and R1 5’-TGCACACCCAGTGTGAATG-3’ designed using Primer3 (23) (version 0.4.0) and acquired from ThermoFisher Scientific ...
-
bioRxiv - Plant Biology 2022Quote: 5’-biotinylated RNA and unmodified RNA of Motif 3 (5’-AAAUCGCCGGAG-3’ 5’-Bio-AAAUCGCCGGAG-3’) were synthesized by Eurofins (Hamburg, Germany) and used for LightShift™ Chemiluminescent RNA EMSA Kit (Thermo Scientific). Total protein was extracted from LL and 10 min LL➔HL-treated plants using extraction buffer (25 mM Tris ...
-
bioRxiv - Immunology 2021Quote: ... Heat-inactivated HSV-1 McKrae strain was used for coating ELISA plates (Nunc Immunosorbent). The affinity of binding of antigen-specific antibodies to the HSV-1 McKrae strain was measured by ELISA plates coated overnight at 4°C with (104 pfu/ well ...
-
bioRxiv - Microbiology 2020Quote: A 96-well enzyme-linked immunosorbent assay (ELISA) plate (Nunc MaxiSorp, Thermo Fisher Scientific) was first coated overnight with 100 ng per well of purified recombinant protein in PBS buffer ...
-
bioRxiv - Microbiology 2020Quote: A 96-well enzyme-linked immunosorbent assay (ELISA) plate (Nunc MaxiSorp, Thermo Fisher Scientific) was first coated overnight with 100 ng per well of purified recombinant protein in PBS buffer ...
-
bioRxiv - Immunology 2022Quote: ... a 96-well flat-bottom NUNC PolySorp ELISA plate (Thermo Fisher Scientific, cat: 456529) was sensitised with 100 µL of 95 µM Streptavidin (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... was coated on Nunc Maxisorp ELISA plates (Thermo Fisher Scientific, Cat# 44-2404-21) at 2.5 µg/mL final concentration in Sodium Bicarbonate buffer (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2020Quote: ... and 100 μl dispensed in triplicate into wells of 96-well ELISA plates (Nunc Maxisorp ...
-
bioRxiv - Bioengineering 2021Quote: ... Plates were developed with 1-step Turbo TMB-ELISA Substrate Solution (Thermo Fisher Scientific) and 2N HCl ...
-
bioRxiv - Immunology 2020Quote: ... followed by addition to the Fc-chimeric human ACE2-coated MaxiSORP ELISA plate (Nunc) for an hour at room temperature ...
-
bioRxiv - Biophysics 2022Quote: ... The plates were developed with TMB-ELISA substrate (Thermo Fisher Scientific, Cat. no. 34028) until the light blue color appeared ...
-
bioRxiv - Immunology 2022Quote: ... Plates were developed with 1-Step™ Ultra TBM-ELISA substrate solution (Thermo Fisher) and stopped with equal volume 1N H2SO4 ...
-
bioRxiv - Neuroscience 2023Quote: ... Plates were developed with 1-Step Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific) for 10-15 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... Supernatants from hybridomas were initially screened using Maxisorb ELISA plates (ThermoFisher Scientific, Roskilde, Denmark) coated with 0.5 µg/mL purified recombinant RBD followed by at least three rounds of cloning by limited dilution ...
-
bioRxiv - Immunology 2023Quote: ... ELISA plates were developed with the TMB substrate (1-Step Turbo-TMB, Thermo Fisher) for six minutes and terminated with sulfuric acid (2M) ...
-
bioRxiv - Immunology 2024Quote: ... Plates were read at 405-650nm with an ELISA reader (Varioskan Flash, Thermo scientific). IgM (clone MADNP5) ...
-
bioRxiv - Cell Biology 2019Quote: RNF168 si #1: 5’- GGCGAAGAGCGAUGGAGGATT-3’ (Ambion)
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP7 siRNA: 5’-GCAACACUUAGAAGGAGAAGGCCUA-3’ (1362318, Invitrogen); GTPBP8 siRNA#1 ...
-
bioRxiv - Cell Biology 2023Quote: DCAF5 5‘-GCAGAAACCUCUACAAGAAdTdT-3’ (Ambion, silencer select)
-
bioRxiv - Cell Biology 2020Quote: ... #3: 5′-GAAUAUUGAACUGGAAGCAGCACAU-3′) were purchased as Stealth RNAi siRNAs from Invitrogen. The target sequences were designed using the Block-iT RNAi Designer tool (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were analyzed in duplicates using Monkey IL6 ELISA and Monkey TNFα Total ELISA kits (ThermoFisher, Waltham, MA) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Total mouse tau ELISA measurements were carried out using a total mouse tau ELISA kit (Thermo Fisher Scientific) according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: Total tau content was quantified in brain extracts by ELISA (Human Tau (total) ELISA kit (#KHB0041, Invitrogen, UK), see supplementary methods ...
-
bioRxiv - Immunology 2021Quote: ... Plates were blocked with 5% FBS (ThermoFisher) or FetalPlex (Gemini Bio ...
-
bioRxiv - Cancer Biology 2020Quote: The 3’ & 5’RACE products were cloned using TOPO TA Cloning Kit (Invitrogen, Cat #K4530-20), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification of cyp51A was performed using the L98HR primer (5’-TTCGGTGAATCGCGCAGATAGTCC-3’) and TR34R primer (5’-AGCAAGGGAGAAGGAAAGAAGCACT-3’) (Invitrogen) at 100 nM ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... oligonucleotides from homologous regions D-ORF5 5′CCGctgagCAAGGTAGCCTCGTCTATTGGAC 3′ and R-ORF7 5′CCGctcgagTTCTTCATCTTCAATATTATGTC3′ were used using the PCR Reagent System Kit (Invitrogen, Life Technologies Inc.). The reaction mixture was prepared with l00 ng of recombinant TnGV DNA ...
-
bioRxiv - Immunology 2024Quote: Sandwich ELISA was used to establish plasma concentrations of IL-18 (Invitrogen, Thermofisher, BMS618-3) and ferritin (Abcam ...
-
bioRxiv - Immunology 2024Quote: Sandwich ELISA was used to establish plasma concentrations of IL-18 (Invitrogen, Thermofisher, BMS618-3) and ferritin (Abcam ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μM of 20-base model RNA (5’-AAUCUAUAAUAGCAUUAUCC-3’; ThermoFisher Scientific) was treated with 300 nM of purified recombinant SARS-Cov2 NSP13 with an N-terminal His-tag (Cayman Chemicals #30589 ...
-
bioRxiv - Microbiology 2023Quote: ... 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated into a PCR by the use of a DreamTaqTM DNA Polymerase (Thermo Scientific™ ...
-
bioRxiv - Cell Biology 2020Quote: ... PDGF-AA ELISA kits (EHPDGF) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: Mouse IL-6 was quantified by uncoated ELISA Kit (ThermoFisher) according to manufacturer’s instruction.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... an interleukin-8 (IL-8) ELISA kit (Invitrogen, Catalog # CHC1303) to quantify secreted IL-8 levels in conditioned media ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Mouse ELISA Interleukin (IL)-6 kit was purchased from Invitrogen, Philippines ...
-
bioRxiv - Immunology 2022Quote: ... IL1β levels were measured using the IL1β ELISA kit (Invitrogen) according to manufacturer instruction ...
-
bioRxiv - Neuroscience 2020Quote: ... was measured with Human Aβ Ultrasensitive ELISA Kit (Invitrogen, #KHB3544).
-
bioRxiv - Immunology 2022Quote: ... following the manufacturer’s instructions (TNF beta Human ELISA Kit, ThermoFisher).