Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for 7 Propyl 3 trifluoromethyl 1 2 benzisoxazol 6 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Invitrogen, D1306). Protein G–Sepharose (GE Healthcare ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific) staining according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) was then added immediately at a concentration of 1:1000 to label DNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... or 4’,6-diamidino-2-phenylindole (DAPI, Molecular Probes) was applied as a nuclear counterstain ...
-
bioRxiv - Systems Biology 2022Quote: ... 6-Diamidino-2-phenylindole (DAPI) staining Hoechst (Invitrogen 33342) was used and added to the secondary antibody staining solution at a dilution of 1:500 ...
-
bioRxiv - Genomics 2019Quote: ... stained with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) at a final concentration of 3 μM ...
-
bioRxiv - Molecular Biology 2021Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride) (Thermo Fisher) at a dilution of 1:5,000 in 1x PBS was used to stain cell nuclei ...
-
bioRxiv - Zoology 2020Quote: ... 6’-diamidino-2-phenylindole (DAPI, Invitrogen, Carlsbad, CA, USA) in dd H2O for 20 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific 62247) was used to counterstain the nuclei.
-
bioRxiv - Cell Biology 2019Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride; Life Technologies) was used to counterstain cell nuclei ...
-
bioRxiv - Biophysics 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies #D1306) was used for nuclei staining in conjunction with secondary antibodies ...
-
bioRxiv - Immunology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (#P36931, Thermo Fisher Scientific) for nuclei counterstaing ...
-
bioRxiv - Developmental Biology 2022Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific 62247) was used to counterstain the nuclei.
-
bioRxiv - Cell Biology 2023Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Life Technologies). Whole-mount stained slices were then washed in PBS and incubated overnight in RapiClear 1.52 ...
-
bioRxiv - Bioengineering 2022Quote: ... LAURDAN (6-dodecanoyl-2-dimethylaminonaphthalene) was purchased from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... with 4’,6-Diamidino-2-Phenylindole (DAPI, Invitrogen, D3571) 1:1000 in 1% BSA included in the second wash ...
-
bioRxiv - Bioengineering 2023Quote: ... and 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI, Invitrogen) staining to visualize the cytoskeleton and nucleus ...
-
bioRxiv - Pathology 2023Quote: ... including 4’,6-Diamidino-2-Phenylindole (DAPI) (ThermoFisher, D1306), were prepared according to the manufacturer’s recommendation and applied to each section ...
-
bioRxiv - Developmental Biology 2022Quote: ... DAPI (4’,6-diamidino-2-phenylindole; Invitrogen REF: D1306) diluted at 1:1000 in PBT was added to the samples for 10 minutes at room temperature on a rotating wheel followed by a wash in PBT for 10 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 4′,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) was used at 0.2μM.
-
bioRxiv - Cancer Biology 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) followed by an appropriate secondary Ab with Alexa Fluor 488 ...
-
bioRxiv - Microbiology 2023Quote: ... Laurdan (6-Dodecanoyl-2 Dimethylaminonaphthalene Thermo Fisher Scientific, MA) was dissolved in DMF (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen Corp., USA) was used for counterstaining ...
-
bioRxiv - Cell Biology 2024Quote: ... 4’,6-diamiino-2-phenylindole (DAPI; Invitrogen, Cat# D21490) diluted 1:1000 in PBS was applied for 15 minutes at room temperature with plates subsequently washed ...
-
bioRxiv - Microbiology 2024Quote: ... and 6 µL 2-mercaptoethanol (Fisher Chemical, Fisher Scientific) were added to a Qiagen powerbead tube ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Plant Biology 2020Quote: General ROS were detected using 2’-7’-dichlorodihydrofluorescein diacetate (CM-H2DCFDA, Invitrogen). CM-H2DCFDA was dissolved in DMSO to give a concentration of 1 mM and further diluted to a final concentration of 50 μM in water ...
-
bioRxiv - Cell Biology 2022Quote: The cell-permeant reagent H2DCFDA (2’, 7’-dichlorodihydrofluorescein diacetate) (Thermo Fisher Scientific) was employed to represent the ROS levels in HeLa cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... for 7 minutes at 20 V using iBlot 2 (Thermo Fisher Scientific). Blots were blocked in 5% dried milk (AppliChem ...
-
bioRxiv - Neuroscience 2021Quote: ... or 10 μM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA; Thermo Fisher Scientific #D399), an MRP family substrate ...
-
bioRxiv - Cell Biology 2022Quote: ... + 1.6 mM Tris pH 7) and mounted in 1.2-2% agarose (Invitrogen) in 35mm #1.5 glass-bottom dishes (CellVis D35-20-1.5N and D35C4-20-1.5N) ...
-
bioRxiv - Cell Biology 2022Quote: ... + 1.6 mM Tris pH 7) and mounted in 1.2-2% agarose (Invitrogen) in 35mm #1.5 glass-bottom dishes (CellVis D35-20-1.5N) ...
-
bioRxiv - Molecular Biology 2023Quote: ... by the iBlot 2 transfer system (Invitrogen, 20 V for 7 min). The membranes were blocked with 3% nonfat milk or ECL PrimeTM blocking agent (Cytiva ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Neuroscience 2021Quote: ... we re-suspended cells in PBS/ 0.2% human serum containing 2 µg/mL 7-aminoactinomycin D (7-AAD) (Invitrogen, Cat# A1310). We carried out isotopic controls with irrelevant mouse IgG1-APC ...
-
bioRxiv - Biophysics 2022Quote: ... and 2-3 μL of the freshly phase-separated sample was placed into a chamber made on a glass slide (Fisher Scientific 3” × 1” × 1 mm). The chamber made by using double-sided tape was then sealed with a square coverslip to avoid evaporation of the sample ...
-
bioRxiv - Immunology 2021Quote: ... 2-3 ml RBC Lysing Buffer (Invitrogen) was added to the pellet containing splenocytes and incubated at room temperature for 5-7 min ...
-
bioRxiv - Microbiology 2020Quote: ... and IFNλ−2/3 (Thermo Scientific Mm04204156_gH) and results were normalized to GAPDH (Mm.PT.39a.1 ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNAs from 7-d-old seedlings grown on 1/2 MS with or without 1 μM ABA were extracted using TRIzol (Invitrogen, Carlsbad, CA, USA) or Universal Plant Total RNA Extraction Kits (Spin-column)-I (BioTeke ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated for overnight with primary antibody at 4 degrees and further incubated with secondary antibodies (1:500) for 1 hour followed by 4′,6-diamidino-2-phenylindole (DAPI) or phalloidin 488 (1:400, Thermo Fisher, A12379) staining ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...
-
bioRxiv - Cell Biology 2023Quote: ... or Stealth siRNAs targeting coding sequences of human EZH2mRNA (5′-GACCACAGUGUUACCAGCAUUUGGA-3′: EZH2 #1, and 5′-GAGCAAAGCUUACACUCCUUUCAUA-3′: EZH2 #2) were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... When switching to differentiation media OLs were labeled with CellROX Deep Red (Thermo Fisher Scientific, Waltham, MA) at a final concentration or 1000nM ...
-
bioRxiv - Cell Biology 2022Quote: ... the samples were added with a DNA-binding dye 4′,6-diamidino-2-phenylindole (DAPI, 1 µg mL-1 in PBS, Invitrogen) and phalloidin conjugated Alexa Fluor dye (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... resuspended in 1 mL NSB with 1:20 dilution of 0.25 mg/ml 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen D1306) and FACS sorted ...
-
bioRxiv - Biophysics 2023Quote: ... the samples were added with a DNA-binding dye 4’,6-diamidino-2-phenylindole (DAPI, 1 μg mL-1 in PBS, Invitrogen) along with the secondary antibody solution ...
-
bioRxiv - Cell Biology 2021Quote: ... embryos at the 3-6 somite stage were embedded oriented laterally in 1% low-melt agarose (Invitrogen, Carlsbad, CA) and imaged under bright field (to determine yolk elongation by taking major and minor axis measurements ...