Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for 7 7R 7 Amino 5 azaspiro 2.4 hept 5 yl 8 chloro 6 fluoro 1 1S 2R 2 fluorocyclopropyl 1 4 dihydro 4 oxo 3 quinolinecarboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole) (1:106, 62248, Invitrogen) for 10 min at room temperature ...
-
bioRxiv - Neuroscience 2019Quote: ... and for nuclei with DAPI (4’,6-Diamidino-2-Phenylindole Dihydrochloride; Invitrogen; 1:500). The antigen-antibody complex was visualized using the secondary antibodies dk anti-ms Rhodamine (1:500 ...
-
bioRxiv - Microbiology 2021Quote: ... along with 1 µg/mL 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen; cat#: 62248) to stain the nuclei and Alexa Fluor 647 phalloidin at 1:100 (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... Slides were stained with 1:10,000 DAPI (4’,6-diamino-2-fenilindol, Molecular Probes), mounted with Prolong Diamond Antifade Mountant (Molecular Probes ...
-
bioRxiv - Neuroscience 2019Quote: ... sections were incubated with 4’,6-diamidino-2-phenylindole (DAPI 1:20000, Fisher Scientific) for 5 minutes before being washed ...
-
bioRxiv - Neuroscience 2021Quote: ... Brain slices were incubated with 4’,6-diaminodino-2-phenylindole (DAPI, Invitrogen, 1:2000) for 10 min and washed with PBS three times before mounting onto slides ...
-
bioRxiv - Cancer Biology 2022Quote: ... Molecular Probes DAPI (4’,6 Diamidino 2 Phenylindole, Dihydrochloride) (1:500, Thermo Scientific, D1306).
-
bioRxiv - Neuroscience 2020Quote: ... sections were counterstained with 4′,6-diamidino-2-phenylindole solution (DAPI, 1:10000, Invitrogen) before being washed in PB 0.05 M and mounted on slides using chromium (3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI; 1:1,000; D1306, Invitrogen). Sections were mounted with ProLong™ Gold Antifade Mountant (P36934 ...
-
bioRxiv - Microbiology 2023Quote: ... DNA were stained with 1 µg/ml 4′′,6-diamidino-2-phenylindole (DAPI, Invitrogen) for 15 min at RT ...
-
bioRxiv - Microbiology 2023Quote: ... cells were stained with 1:1000 DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, Invitrogen) for 10 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... After counterstaining with 4′,6-diamidino-2-phenylindole (DAPI, 1:5,000, #62248, Thermo Scientific), slides were mounted using ProLong Gold Antifade Mountant with DAPI (#P39941 ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated with 4’,6-diamidino-2-phenylindole (DAPI,1:20000, Invitrogen D3571) diluted in PBS to visualize cell nuclei (data not shown) ...
-
Glycogen Synthase Kinase 3 regulates the genesis of the rare displaced ganglion cell retinal subtypebioRxiv - Neuroscience 2021Quote: ... Sections were counterstained with 1:1000 4′,6-diamidino-2-phenylindole (DAPI) (1 mg/mL, Thermo Scientific).
-
bioRxiv - Microbiology 2019Quote: ... ATPase was assayed by a continuous spectrophotometric method using a 2-amino-6-mercapto-7-methylpurine ribonucleoside/purine nucleoside phosphorylase reaction to detect the released inorganic phosphate (EnzChek Kit; Life Technologies, California, USA) (53) ...
-
bioRxiv - Immunology 2021Quote: ... was added to a concentration of 1X and 12.5-30 μg of total protein from each sample was resolved on NuPAGETM 4-12% BisTris (Phospho-PMK-1 and Total-PMK-1) or NuPAGETM 3-8% TrisAcetate (TIR-1::3xFLAG) gels (ThermoFisher Scientific), transferred to nitrocellulose membranes using a Trans-Blot Turbo Transfer System (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated 5 minutes with at room temperature with 500 ng/ml 4’,6-Diamidino-2-Phenylindole Dilactate (DAPI; ThermoFisher) in DPBS and mounted in ProLong®Gold (ThermoScientific).
-
bioRxiv - Cell Biology 2019Quote: ... or caspases 3/7 (Caspase-3/7 Green ReadyProbes™ reagent with a DEVD sequence, Molecular Probes).
-
bioRxiv - Cell Biology 2019Quote: ... or caspases 3/7 (Caspase-3/7 Green ReadyProbes™ reagent with a DEVD sequence, Molecular Probes).
-
bioRxiv - Immunology 2023Quote: ... The caspase-3/7 activity assay contained CellEvent Caspase- 3/7 Green Detection Reagent (Thermo Fisher, C10723) at a final ...
-
bioRxiv - Cell Biology 2019Quote: RNF168 si #1: 5’- GGCGAAGAGCGAUGGAGGATT-3’ (Ambion)
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then washed and stained for 20 min at 4 °C with the following antibodies: anti-mouse CD8α APC-efluo780 (clone 53-6-7, ebioscience/ Thermofisher), anti-mouse CD8β AF700 or BUV495 (clone YTS156 ...
-
bioRxiv - Microbiology 2021Quote: ... CAS number: 328–42–7), 2-Ketoglutaric acid, disodium salt, dehydrate (>99%, CAS number: 305–72–6) were purchased from Acros Organics, Belgium ...
-
bioRxiv - Microbiology 2023Quote: ... Total DNA was stained using 4’,6-diamidino-2- phenylindole (DAPI) diluted 1:10000 in PBS containing 3% BSA (Molecular Probes) to illuminate host cell nuclei ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Microbiology 2019Quote: ... 5 µM fluo-4 AM (Invitrogen) was added to the cultures for 1 h ...
-
bioRxiv - Plant Biology 2022Quote: ... N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM 4-64; 50 μM) (Invitrogen) or propidium iodide (PI ...
-
bioRxiv - Bioengineering 2022Quote: ... 1% glutamine and 1% non-essential amino acids (Gibco). In the instance of the HUVEC Deficient Organoids (HDOs ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 mM non-essential amino acids (Invitrogen, 1:100), GlutaMax (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclear stain: 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI, blue; 2 ng ml−1; Molecular Probes, USA). Sections were cover-slipped using ProLong Gold anti-fade reagent (Invitrogen ...
-
bioRxiv - Systems Biology 2021Quote: ... and 1:1000 7-AAD (ThermoFisher Scientific). Mouse IgG2A-488 (R&D systems ...
-
bioRxiv - Neuroscience 2021Quote: ... HT-7 (1:200, #MN1000, Thermo Scientific), GPC-4 (1:200 ...
-
bioRxiv - Cell Biology 2020Quote: ... Claudin 7 (Fisher Scientific 10537403, 1:200), Large T (Santa Cruz sc-20800 ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Thy1.1 (1:500, OX-7; Invitrogen) anti-CD4 (1:500 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 7-AAD (Invitrogen, Carlsbad, CA; 1:1000) was used to determine dead cells ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cancer Biology 2022Quote: ... 5 and 7 days in culture by staining with trypan blue (Invitrogen) or counting with an automated cell counter for viable cells (Fluidlab R-300 cell counter ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 5-7 minutes before quenching with Knock-Out Media (ThermoFisher Scientific) and centrifuging at 200g for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... Approximately 5-7 µL of NativeMark Unstained Protein standard from Invitrogen (LC0725) was used as the ladder ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 × 10-4 M MTG and 5% Protein-Free Hybridoma Media II (Gibco).
-
bioRxiv - Microbiology 2020Quote: ... washed in 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Thermo Fisher Scientific, Waltham, MA, USA) two times ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Lot 134874), and 4-(2-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, purity ≥ 99.%, CAT #BP310-1, Lot 052975) were from Thermo Fisher Scientific (Waltham ...
-
Controlled Fluorescent Labelling of Metal Oxide Nanoparticles for Artefact-free Live Cell MicroscopybioRxiv - Biophysics 2021Quote: ... 1% NEAA (non-essential amino acids, Gibco) in an incubator at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% non-essential amino acids (Life Technologies), and 0.2% penicillin-streptomycin solution (Life Technologies) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% MEM non-essential-amino-acids (Gibco) and 1 µg/ml heparin (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM non-essential amino acids (Gibco), 100 units/ml human LIF supplemented with 10% fetal bovine serum (Gibco) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1% MEM non-essential amino acids (Gibco), 1% GlutaMax (Gibco) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1% non-essential amino acids (NEAA, Invitrogen) and 1000 U/mL LIF (ESGRO ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1× non-essential amino acids (both Gibco) and 100 U ml-1 penicillin and 100 µg ml-1 streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2020Quote: ... 1% non-essential amino acids (NEAA; Gibco) and 1% Penicillin-streptomycin (pen-strep ...