Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for 2 5 Sulfanyl 4H 1 2 4 triazol 3 yl phenol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Slides were stained with 1:10,000 DAPI (4’,6-diamino-2-fenilindol, Molecular Probes), mounted with Prolong Diamond Antifade Mountant (Molecular Probes ...
-
bioRxiv - Bioengineering 2021Quote: FBS free culture media with 15mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (Gibco) in DMEM/F12 supplemented with 1% P/S was used for all experiments performed in the lung on a chip devices ...
-
bioRxiv - Neuroscience 2021Quote: ... Brain slices were incubated with 4’,6-diaminodino-2-phenylindole (DAPI, Invitrogen, 1:2000) for 10 min and washed with PBS three times before mounting onto slides ...
-
bioRxiv - Cancer Biology 2022Quote: ... Molecular Probes DAPI (4’,6 Diamidino 2 Phenylindole, Dihydrochloride) (1:500, Thermo Scientific, D1306).
-
bioRxiv - Neuroscience 2020Quote: ... sections were counterstained with 4′,6-diamidino-2-phenylindole solution (DAPI, 1:10000, Invitrogen) before being washed in PB 0.05 M and mounted on slides using chromium (3 ...
-
bioRxiv - Neuroscience 2021Quote: ... buffered with 10mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 1M (ThermoFisher, ref. 15630106) and coated with 20 μg/mL laminin (Sigma Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... 1-2 x 107 cells were incubated in 4 µM PBS-diluted CFSE (Invitrogen) for 10 min ...
-
bioRxiv - Microbiology 2023Quote: ... DNA were stained with 1 µg/ml 4′′,6-diamidino-2-phenylindole (DAPI, Invitrogen) for 15 min at RT ...
-
bioRxiv - Microbiology 2023Quote: ... cells were stained with 1:1000 DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, Invitrogen) for 10 minutes ...
-
bioRxiv - Developmental Biology 2022Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI; 1:1,000; D1306, Invitrogen). Sections were mounted with ProLong™ Gold Antifade Mountant (P36934 ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated with 4’,6-diamidino-2-phenylindole (DAPI,1:20000, Invitrogen D3571) diluted in PBS to visualize cell nuclei (data not shown) ...
-
bioRxiv - Biophysics 2024Quote: ... HEPES ((4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid)) was obtained from Fisher Scientific (Pittsburg, PA). Peptides were reconstituted at 25 mg ml-1 in nuclease-free ultra pure water as per the manufacturer’s instructions and stored as aliquots at -20°.HP1α was reconstituted (0.5 mg ml-1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... After counterstaining with 4′,6-diamidino-2-phenylindole (DAPI, 1:5,000, #62248, Thermo Scientific), slides were mounted using ProLong Gold Antifade Mountant with DAPI (#P39941 ...
-
bioRxiv - Microbiology 2022Quote: ... and 15 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco, Gaithersburg, MD, USA). Cells were maintained at 37 °C in a humidified incubator with 5% CO2.
-
bioRxiv - Microbiology 2024Quote: ... for 1 h at 4°C.The DynaMag™-2 magnetic rack (Thermo Fisher Scientific) was used for flow-through removal and washing ...
-
bioRxiv - Neuroscience 2024Quote: ... nuclei were stained with 1:1000 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen, D1306) for visualisation of tissue structure ...
-
bioRxiv - Microbiology 2024Quote: ... as well as DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (1:1000; Invitrogen, #D1306) were diluted in DPBS with 1% FBS and incubated for 2 h at 4 °C ...
-
bioRxiv - Systems Biology 2024Quote: ... A 1:5000 solution of DAPI (4’,6-diamidino-2-phenylindole) (Thermo Fisher, 62248) diluted blocking buffer was added for 15 mins at room temperature to stain for DNA ...
-
bioRxiv - Cell Biology 2024Quote: ... Nuclei were stained with 4′-6-diamidino-2-phenylindole (DAPI) (1 µg/mL, Invitrogen), and actin with Alexa FluorTM 647/546-labelled phalloidin (1:400 ...
-
bioRxiv - Genetics 2023Quote: ... Extracts were incubated with rotation with rabbit polyclonal anti-Piwi antibodies (4 µg per sample) at 4°C for 4h followed by overnight incubation with DynabeadsTM Protein A (50 µl, Invitrogen, 10002D) at 4°C with rotation ...
-
bioRxiv - Physiology 2023Quote: ... cells were incubated with fresh DMEM containing DDAO galactoside (9H-(1,3-dichloro-9,9-dimethylacridin-2-one-7-yl) β-D-Galactopyranoside) (Molecular Probes™) for 2 hours ...
-
bioRxiv - Neuroscience 2020Quote: NO production was detected by DAF-FM diacetate (4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate) (D23844, ThermoFisher). Fly larvae were dissected at 24 or 48 h AI in PBS to expose the sensory neurons ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% 2-mercaptoethanol] and was resolved by SDS-PAGE on 4% to 12% Bis-Tris gels (Invitrogen). Proteins were transferred to a polyvinylidene difluoride immobilon TM-P membrane (Millipore ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% v/v 2-mercaptoethanol) and fractionated by 4–12% Bis-Tris gel (Thermo Fisher Scientific Cat#NP0335BOX) using MES running buffer (Thermo Fisher Scientific Cat#NP000202) ...
-
bioRxiv - Immunology 2024Quote: ... we injected the mice intraperitoneally with 4 mg/ml of 5-ethynyl-2′-deoxyuridine (EdU) (Invitrogen, Waltham, MA) with the goal of labeling circulating monocytes to assess macrophage retention among groups ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% v/v 2-mercaptoethanol) and fractionated by 4–12% Bis-Tris gel (Thermo Fisher Scientific Cat#NP0335BOX) using MES running buffer (Thermo Fisher Scientific Cat#NP000202) ...
-
bioRxiv - Neuroscience 2020Quote: ... Nuclei were stained with 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/ml, Molecular Probes). The sections were mounted using a fluorescence mounting medium (DAKO ...
-
bioRxiv - Genomics 2023Quote: ... The nuclear stain was 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/mL; Molecular Probes). Sections were imaged digitally using a slide scanner (Olympus VS-120 Slide scanner ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were incubated with 4 μM fura-2 acetoxymethyl ester (fura-2/AM, Invitrogen, Cat# M1291) in HEPES-buffered solution (137 mM NaCl ...
-
bioRxiv - Microbiology 2020Quote: ... 20 μl RNase A/T1 mix (2 μg μl−1 / 5 U μl−1, Thermo Scientific) was added to 100 μl lysate (OD260 ~ 150 ...
-
bioRxiv - Bioengineering 2022Quote: RPTEC organoids were imaged every 2-3 days with a EVOS FL 2 Auto microscope (Thermo Fisher) with a 4x objective ...
-
bioRxiv - Cancer Biology 2023Quote: ... The lungs were inflated with 1-3 ml 2% UltraPure Low Melting Point Agarose (Invitrogen). Lungs and livers were fixed overnight at 4°C on a shaker ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... The culture medium was changed every 2 to 3 days and the cells were split every 5 to 7 days using 0.25% Trypsin-EDTA (Gibco), up to 20 times ...
-
bioRxiv - Molecular Biology 2022Quote: Fresh tissue samples were washed 2–3 times in PBS and incubated in 5 U/ml dispase (ThermoFisher Scientific) supplemented with antibiotics (penicillin 50U/I and streptomycin 50 mg/ml ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... were maintained in a water jacketed 5 % CO2 incubator and passaged every 2-3 days using trypsin/EDTA (Gibco). 1E6 cells were seeded into 6 well plates ...
-
bioRxiv - Cell Biology 2020Quote: ... Peptides were separated within a 25 min gradient (3 – 35% acetonitrile) on a monolith column (ProSwift™ RP-4H, 1 mm x 250 mm, Thermo Fisher Scientific) using an HPLC system (Agilent 1200 series ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5% mercapto-2-ethanol and 1X Halt Protease Inhibitor Cocktail (Thermo Scientific; 1:200). Proteins were separated using SDS-PAGE ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies #D1306) was used for nuclei staining in conjunction with secondary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 M thiourea and 4% CHAPS (Thermo Fisher Scientific). Each combined replicate of samples was loaded onto a QIAshredder spin column (QIAGEN ...
-
bioRxiv - Neuroscience 2020Quote: DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Invitrogen, # D1306)
-
bioRxiv - Bioengineering 2020Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen D1306) for 30 min at room temperature.
-
bioRxiv - Cell Biology 2021Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Invitrogen, D1306). Protein G–Sepharose (GE Healthcare ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific) staining according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) was then added immediately at a concentration of 1:1000 to label DNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... or 4’,6-diamidino-2-phenylindole (DAPI, Molecular Probes) was applied as a nuclear counterstain ...
-
bioRxiv - Neuroscience 2021Quote: ... flash frozen in 2-methylbutane (Fisher Scientific, 03551-4), and kept at −80°C until sliced on a cryostat (Leica ...
-
bioRxiv - Molecular Biology 2021Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride) (Thermo Fisher) at a dilution of 1:5,000 in 1x PBS was used to stain cell nuclei ...
-
bioRxiv - Developmental Biology 2021Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific 62247) was used to counterstain the nuclei.
-
bioRxiv - Biophysics 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies #D1306) was used for nuclei staining in conjunction with secondary antibodies ...