Labshake search
Citations for Bioo Scientific Corporation :
151 - 200 of 201 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: Whole genome sequencing (WGS) libraries were prepared using Illumina-compatible NEXTFlex Rapid DNA sequencing Bundle (BIOO Scientific, Inc. U.S.A.) at Genotypic Technology Pvt ...
-
bioRxiv - Immunology 2020Quote: One hundred μg aliquots of total RNA preparation were brought to 100 μl in nuclease free water and poly-A selected using NEXTflex Poly(A) Beads (BIOO Scientific Cat#NOVA-512980) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... library preparation protocol to use Barcodes from BIOO Scientific added by ligation ...
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries preparation for sequencing was performed by using NEXTflex ChIP-Seq Kit (Bioo Scientific, NOVA-5143-01) without size selection.
-
bioRxiv - Genomics 2020Quote: ... containing 10 pmol of barcoded primers (adapted from NEXTflexTM 16S V1-V3 Amplicon Seq Kit, Bioo Scientific, Austin, USA) for a second amplification (95°C for 15 min ...
-
bioRxiv - Neuroscience 2020Quote: ... 55°C for 30sec and 72°C for 1min sequencing libraries were prepared using the NETflex DNA Sequencing Kit (BIOO Scientific, Austin, TX) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA fragments were ligated to NEXTflex dual adapters (Bioo Scientific). The quality and quantity of the finished libraries were assessed using a combination of Agilent DNA High Sensitivity chip (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNAs were generated using random hexamers and ligated to barcoded Illumina adaptors with the NEXTflex Rapid Directional RNA-Seq Library Prep Kit (Bioo Scientific). Sequencing of 75 nucleotide-long single-end reads was performed in a NextSeq-500 (Illumina).
-
A novel neural stem cell-derived immunocompetent mouse model of glioblastoma for preclinical studiesbioRxiv - Cancer Biology 2020Quote: ... 8 bp single-index NEXTflex DNA barcodes (Bioo Scientific) were used ...
-
bioRxiv - Microbiology 2020Quote: ... 2.5 μL of 250 nM of NEXTflex Dual-Index DNA barcodes (Bioo Scientific) were used with 15 μL of end-repair reaction product ...
-
bioRxiv - Genetics 2020Quote: ... In total 8 groups were prepared for RNA-seq libraries with 500 ng mRNA as starting materials using NEXTflex Illumina qRNA-Seq Library Prep Kit (Bioo Scientific). In short ...
-
bioRxiv - Neuroscience 2020Quote: ... Poly-adenylated RNA was isolated from each sample using the NEXTflex PolyA Bead kit (Bioo Scientific, Austin, TX, USA) following manufacturer guidelines ...
-
bioRxiv - Neuroscience 2020Quote: ... Strand specific libraries for each sample were prepared using the dUTP NEXTflex RNAseq kit (Bioo Scientific), which includes a magnetic bead-based size selection ...
-
bioRxiv - Microbiology 2020Quote: ... poly adenylated and ligated to a 6bp DNA barcodes (Bioo Scientific NextFlex DNA barcodes) using a PrepX Complete ILMN DNA Library kit (Takara Bio ...
-
bioRxiv - Microbiology 2020Quote: ... The library was constructed using the NEXTflex Rapid DNA-Seq kit (Bioo Scientific, Austin, TX), the quality of sequencing reads was analyzed using FastQC (Babraham Bioinformatics) ...
-
bioRxiv - Microbiology 2020Quote: The library was constructed using NEXTflex Rapid DNA-Seq kit v2 (Bioo Scientific) and the NEXTflex Illumina DNA barcodes after shearing the DNA with a Covaris S220 instrument ...
-
bioRxiv - Cancer Biology 2020Quote: ... primer mix (Bioo Scientific), dNTP mix (Promega) ...
-
bioRxiv - Cell Biology 2020Quote: ... The unique dual index sequences (NEXTFLEX® Unique Dual Index Barcodes, BioO Scientific) were incorporated in the adaptors for multiplexed high-throughput sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... NGS library preparation was performed with NEXTFLEX® Small RNA-Seq Kit v3 (Bioo Scientific®) following Step A to Step G of the manufacturer’s standard protocol (v16.06) ...
-
bioRxiv - Neuroscience 2020Quote: ... mRNA was purified from 2 μg of total RNA by NEXTflex poly(A) beads (Bioo Scientific, 512981), subjected to fragmentation and first and second strand syntheses ...
-
bioRxiv - Cancer Biology 2020Quote: ChIP-Seq libraries were prepared using the NEXTflex ChIP-Seq Kit (Bioo Scientific, ref. 5143-02) following the manufacturer’s protocol with some modifications ...
-
bioRxiv - Cancer Biology 2020Quote: ... Illumina-compatible NEXTflex Directional RNA-Seq Kit (Bioo Scientific) according to the manufacturer’s directions ...
-
bioRxiv - Biochemistry 2020Quote: ... Library preparation for deep sequencing was performed using the NextFlex Rapid Directional qRNA-Seq Library Prep Kit (Perkin Elmer, Bioo Scientific, NOVA-5130-01D) according to the manufacturer’s instructions using 7 unique barcodes ...
-
bioRxiv - Cancer Biology 2020Quote: RNA sequencing libraries were generated from HCC1954 cells at 72 hours post-transfection with the NEXTFLEX® Rapid Directional RNA-Seq Kit (Bioo Scientific, Catalog #NOVA-5138-07) according to the manufacturer’s instructions and samples were sequenced (single-end 50 bp ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and strand-specific libraries were built using the NEXTflex™ Rapid Illumina Directional RNA-Seq Library Prep Kit (Bioo Scientific) with modifications suggested by Sultan et al ...
-
bioRxiv - Genomics 2020Quote: ... and ligated to methylated Illumina TruSeq adapters (BIOO Scientific) with DNA Ligase (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Strand specific 4sU-seq libraries were generated using 75 ng of 4sU-RNA and the NextFlex Rapid Directional RNA-seq kit (Bioo Scientific #NOVA-5138-07) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... were enriched for poly(A)+ messenger RNA using NEXTflex Poly(A) Beads (BIOO Scientific, #NOVA-512980) according to the protocol in the manual ...
-
bioRxiv - Neuroscience 2020Quote: ... Reads from bulk samples were deduplicated using a bash script by BIOO Scientific (v2, date 11/1/14), using the NEXTflex barcode that was saved in the additional file ...
-
bioRxiv - Neuroscience 2020Quote: ... Fourteen µL of this mRNA-enriched poly(A)-tailed RNA was used as the input for the NEXTflex Rapid Directional qRNA-Seq kit (Bioo Scientific, #NOVA-5130-04). Library preparation was performed according to the manufacturers protocol ...
-
bioRxiv - Microbiology 2020Quote: ... and libraries were prepared using NEXTflex™ Dual-Index adapters (Bioo Scientific, Austin, Texas) in an automated fashion (SPRIworks Fragment Library System II ...
-
bioRxiv - Plant Biology 2020Quote: ... and individual indexes and adapters (#520999; Bioo Scientific, Austin, TX, USA) were ligated onto each sample ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... total RNA was used to construct barcoded cDNA libraries using a NEXTflex™ Rapid Directional mRNA-seq kit (Bioo Scientific). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... ChIP DNA libraries were ligated with the Bioo scientific barcoded adaptors (BIOO Scientific, Perkin Elmer, USA) with T4 DNA ligase according to KAPA LTP library preparation protocol and the ligated ChIP DNA libraries were purified with 1.8x vol ...
-
bioRxiv - Immunology 2020Quote: ... Agencourt AMPure XP beads and PCR amplified using KAPA hot start High-Fidelity 2X PCR Master Mix and NextFlex index primers (Bioo Scientific, PerkinElmer) for 12 cycle by following thermocycler cycles ...
-
bioRxiv - Developmental Biology 2020Quote: ... mRNA enriched sequencing libraries were made with the NEXTflex Rapid Directional RNAseq Kit (BioO Scientific Corp.) and corresponding protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... Barcoded sequencing libraries were prepared using NextFlex Rapid DNA-Seq Kits (Bioo Scientific, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... Multiplexed cDNA libraries were prepared with the NEXTFlex Small RNA-Seq Kit v3 (BIOO Scientific, #NOVA-5132-06) according to the manufacturer’s protocol and sequenced (single-end ...
-
bioRxiv - Genetics 2020Quote: ... and G16 from cage 1:3B) using the NEXTFLEX PCR-free library preparation kit and NEXTFLEX Unique Dual Index Barcodes (BIOO Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... and used as input for small RNA library prep using the NEXTflex Small RNA-Seq Kit v3 (Bioo Scientific - PerkinElmer NOVA-5132-06). Libraries were prepared according to manufacturer’s instructions (V19.01) ...
-
bioRxiv - Genetics 2020Quote: ... Genomic DNA was fragmented with a COVARIS S2 and an Illumina-compatible library was prepared with the NEXTflex Bisulfite Library Prep Kit for Illumina Sequencing (Bioo Scientific/PerkinElmer, Austin, Texas, U.S.A). Bisulfite conversion was performed using the EZ DNA Methylation Gold Kit (Zymo Research ...
-
bioRxiv - Cell Biology 2020Quote: ... mRNA enrichment was performed using NEXTflex™ Poly(A) Beads (BIOO Scientific Corporation, Texas, USA) before library preparation with the NEXTflex Rapid Directional qRNA-Seq Library Prep kit for Illumina sequencing (BIOO Scientific Corporation ...
-
bioRxiv - Cell Biology 2020Quote: ... before library preparation with the NEXTflex Rapid Directional qRNA-Seq Library Prep kit for Illumina sequencing (BIOO Scientific Corporation, Texas, USA). This library preparation kit assigns a unique molecular identifier (UMI) ...
-
bioRxiv - Genomics 2020Quote: ... libraries were prepared using the NEXTflexTM Rapid RNA-seq Kit (Bioo Scientific). Libraries were sequenced on the Nextseq500 platform (Illumina) ...
-
bioRxiv - Bioengineering 2020Quote: ... Barcodes with Illumina adapters were purchased from Bioo Scientific (Austin, TX).
-
bioRxiv - Cell Biology 2020Quote: ... Poly-A tail selection was used to enrich for messenger RNA (mRNA) using the NEXTflex Poly(A) Beads kit (Bioo Scientific Corp, cat #512980). RNA-Seq library preparation was carried out using NEXTflex Rapid Directional qRNA-Seq kit (Bioo Scientific ...
-
bioRxiv - Immunology 2020Quote: ... MaxDiscovery Blood Urea Nitrogen Enzymatic Assay Kits were used to quantify BUN via colorimetric assay (Bioo Scientific Corporation, Austin, TX) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... and ligating multiplexed adapters (Illumina-compatible Bioo Scientific). Agencourt AmpureXP beads (Beckman Coulter ...
-
bioRxiv - Genetics 2020Quote: ... the 3’ adaptor sequence were trimmed (TGGAATTCTCGGGTGCCAAGG) and then four bases were trimmed from each end of the read following vendor’s recommendation (BIOO scientific, Austin TX). For NHBCS reads ...
-
bioRxiv - Bioengineering 2020Quote: ... Blood urea nitrogen (Bioo Scientific, Austin, TX, USA) and urine creatinine (Crystal Chem ...