Labshake search
Citations for Cell Signaling Technology :
1 - 50 of 283 citations for Human ADH5 siRNA since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Scramble siRNA (Cell Signaling) was used as control ...
-
bioRxiv - Systems Biology 2020Quote: ... Figure S5 shows the knockdown efficiency of siRNA transfections in each cell line with GAPDH siRNA compared to no siRNA (just N-TER transfection reagent) and negative control siRNA by Western blot (GAPDH antibody: Cell Signaling Technology, Cat#2118 ...
-
bioRxiv - Biochemistry 2024Quote: ... The siRNAs used in this study include control siRNA (SIC) (Cell Signaling Technology (CST) 6568) ...
-
bioRxiv - Biochemistry 2023Quote: Prevalidated human-specific MLL2 small-interfering RNA (Silencer® MLL2 siRNA #AM16708) and control siRNA (SignalSilence® Control siRNA#6568) were purchased from Cell Signaling Technology. TERF2IP siRNA and TRF2 siRNA were designed and ordered from GeneCust (Boynes France) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The following siRNAs were used for functional assays: siRNA FYN#1 (Cell Signaling Technology #12473), siRNA FYN#2 5’GGCCCTTTATGACTATGAATT3’ ...
-
bioRxiv - Cancer Biology 2024Quote: ... SAPK/JNK siRNA and ERK1/2 siRNA were obtained from Cell Signaling Technology (Denver, Massachusetts, USA). Propidium iodide was bought from Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... with siRNA against Atg7 (50nM, Cell Signaling). Scramble siRNA (Cell Signaling ...
-
bioRxiv - Cell Biology 2023Quote: ... and negative control siRNAs (Cell Signaling Technology) were transfected to cells to evaluate the effect of downregulating the expression of AP2A1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and ERK1 siRNA (Cell Signaling Technology, #6436), ERK2 siRNA (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2020Quote: ... the cells were transfected with 100nM SAPK/JNK siRNA I or control siRNA (Cell Signaling Technology Inc., MA, USA) by using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Systems Biology 2023Quote: siRNAs against ERK1/2 (#6560) and AKT1/2 (#6211) and SignalSilence control siRNA (#6568) were purchased from Cell Signaling Technology and were used at 10 µM ...
-
bioRxiv - Cancer Biology 2020Quote: ... Rb siRNA was purchased from Cell Signaling Technology.
-
bioRxiv - Cancer Biology 2023Quote: ... the mouse specific Smad4 siRNA (Cat.12791; Cell Signaling) and the Signal Silence Control siRNA (Cat.6568S ...
-
bioRxiv - Microbiology 2022Quote: ... SignalSilence® FoxO1 siRNA I (Cell Signaling TechCat # 6302). RNA was extracted from HFF at indicated time points using the RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: siRNAs for PARP1 (#6304) were purchased from Cell Signaling Technology Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... Lipofection with scrambled siRNA and p53si RNA (Cell Signaling Technology) was performed approximately 24 h after cell plating using Effectene Transfection Reagent (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... SignalSilence® FoxO1 siRNA I (Cell Signaling Tech, Cat# 6242), SignalSilence® FoxO1 siRNA I (Cell Signaling TechCat # 6302) ...
-
bioRxiv - Molecular Biology 2023Quote: ... SET8 siRNA sequence was provided and validated by Cell Signaling (#1307). The other validated siRNA sequences were provided by Sigma-Aldrich (MISSION® esiRNA) ...
-
bioRxiv - Cancer Biology 2024Quote: ... p38 siRNA were bought from Cell Signaling Technology (Denver, Massachusetts, USA). Transwell insert plates were taken from ThermoFisher Scientific and matrigel from Corning ...
-
bioRxiv - Bioengineering 2024Quote: ... a final concentration of 100 nM CTNNB1 siRNA (Cell Signaling, cat # 6225) was transfected in each well of a 96-well plate (100 μl per well ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA for mTOR (catalog #6381S) was obtained from Cell Signaling Technology (Danvers, MA). ON-TARGET Plus non-targeting pool (Catalog # D-001810 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the Signal Silence Control siRNA (Cat.6568S; Cell Signaling, Danvers, MA, USA) were used ...
-
bioRxiv - Microbiology 2024Quote: ... GECs were treated with HSp27-specific siRNA (100 nM, Cell Signaling Technology, 6356S) or LC3C-specific siRNA (100 nM ...
-
bioRxiv - Microbiology 2024Quote: ... human phosphoRIPK1 (Cell Signaling # 65746S ), human RIPK3 (Cell Signaling # 13526) ...
-
bioRxiv - Microbiology 2024Quote: ... human RIPK1 (Cell Signaling # 3493S), human phosphoRIPK1 (Cell Signaling # 65746S ) ...
-
bioRxiv - Microbiology 2024Quote: ... human phosphoRIPK3 (Cell Signaling # 57220S), human ZBP1 (Novus Biologicals # NBP1-7654) ...
-
bioRxiv - Microbiology 2024Quote: ... human RIPK3 (Cell Signaling # 13526), human phosphoRIPK3 (Cell Signaling # 57220S) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and SignalSilence® p53 siRNA I (#6231) were purchased from Cell Signaling Technology (Danvers, MA, USA). DCFDA/H2DCFDA – cellular ROS assay kits (ab113851 ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse anti-human/rat CD44 (5640S) and rabbit anti-human/mouse ALDH1A1 (12035S) (Cell Signaling Technology), rabbit anti-human/mouse CD36 (ab133625 ...
-
bioRxiv - Pathology 2024Quote: ... human liver sections were incubated at 4 °C overnight with anti-human TIM4 (Cell signaling technology, #75484T ...
-
bioRxiv - Cancer Biology 2020Quote: ... human PDL1 (E1L3N; Cell Signaling Technology), and EF5 (ELK3-51 ...
-
bioRxiv - Immunology 2020Quote: ... rabbit-anti-human FOXO1 (Cell Signaling) and mouse-anti-human CD3 (UCHT1 ...
-
bioRxiv - Neuroscience 2020Quote: ... or human IGF-I (Cell Signaling) was applied to the cultured CGCs at DIV2 ...
-
bioRxiv - Immunology 2021Quote: ... human anti-Iκbζ (9244, Cell signaling), human/mouse anti-YY1 (sc-7341 ...
-
bioRxiv - Cancer Biology 2024Quote: ... rabbit anti-human HMGA2 (Cell Signaling) or rabbit anti human HMGA2 (New England Biolabs), ...
-
bioRxiv - Cell Biology 2020Quote: ... and human LAMP1 (Cell Signaling Technologies; 9091) diluted in blocking buffer ...
-
bioRxiv - Immunology 2021Quote: ... anti-mouse/human STING (Cell Signaling #13647), anti-human phospho-IRF3 (Abcam ab196035) ...
-
bioRxiv - Immunology 2021Quote: ... anti-human phospho-STING (Cell Signaling #19781), anti-mouse phospho-STING (Cell Signaling #72971) ...
-
bioRxiv - Immunology 2021Quote: ... anti-mouse/human Actin (Cell Signaling #3700), anti-human phospho-STING (Cell Signaling #19781) ...
-
bioRxiv - Immunology 2021Quote: ... anti-human cGAS (Cell Signaling Technology, #79978), anti-mouse cGAS (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2020Quote: ... Human recombinant EGF was from Cell Signaling and was used at a 100 ng/mL working concentration (WC) ...
-
bioRxiv - Immunology 2020Quote: ... rabbit anti-human RelA antibody (Cell Signaling) or mouse anti-beta-actin antibody (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... Human OCT4 (Cell Signaling Technology, Cat#4641) and CCND1 (Cell Signaling Technology ...
-
bioRxiv - Immunology 2021Quote: ... rabbit-anti human pTBK1 (#5483, Cell Signaling), rabbit-anti human STING (#13647S ...
-
bioRxiv - Immunology 2021Quote: ... rabbit-anti human pSTING (#19781 Cell Signaling), rabbit-anti human pTBK1 (#5483 ...
-
bioRxiv - Immunology 2021Quote: ... rabbit-anti human TBK1 (#3504, Cell Signaling) or rabbit-anti human TREX1 (#185228 ...
-
bioRxiv - Immunology 2021Quote: ... rabbit-anti human STING (#13647S, Cell Signaling), rabbit-anti human TBK1 (#3504 ...
-
bioRxiv - Immunology 2021Quote: ... rabbit-anti human pIRF3 (#29047, Cell Signaling), rabbit-anti human pSTING (#19781 Cell Signaling) ...
-
bioRxiv - Immunology 2021Quote: ... rabbit-anti human IRF3 (#4302, Cell Signaling), rabbit-anti human pIRF3 (#29047 ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human phosphorylated Paxillin (Cell Signaling Technology) and anti-humanKi67 (Abcam) ...