Labshake search
Citations for Cell Signaling Technology :
101 - 150 of 572 citations for Multiplex Assay kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: Senescence-associated β galactosidase assay was performed according to the manufacturer’s protocol and as described above (Cell Signaling Technology, Kit #9860). 5,000 cells were plated on each well of a 96-well dish ...
-
bioRxiv - Genomics 2023Quote: CUT&RUN experiments were conducted using the CUT&RUN (Cleavage Under Targets & Release Using Nuclease) assay kit (Cell Signaling Technology, #86652) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: CUT&RUN (Cleavage Under Targets & Release Using Nuclease) libraries were prepared with the established CUT&RUN Assay Kit (Cell Signaling, #86652S). The following antibodies were used ...
-
bioRxiv - Molecular Biology 2023Quote: The chromatin immunoprecipitation (ChIP) assay was performed with SimpleChIP® Plus Enzymatic Chromatin IP Kit (Magnetic Beads) (Cell signaling technology, #9005) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ChIP assays were performed in WT and Arp5-KO RD cells using the SimpleChIP Plus Enzymatic Chromatin IP Kit (Cell Signaling Technology) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... quantified with Quantitative Colorimetric Peptide Assay (Thermo Fischer Scientific) and dried on Speed-Vacuum before enrichment with Ubiquitin Remnant Motif (K-ε-GG) Kit (Cell Signaling). After Sep Pak desalting ...
-
bioRxiv - Physiology 2020Quote: ChIP assays of frozen liver tissues of humanized mice were performed using a Simple ChIP Enzymatic Chromatin IP kit (Cell Signaling Technology) according to the manufacturer’s protocol ...
-
Hydrogen sulfide blocks HIV rebound by maintaining mitochondrial bioenergetics and redox homeostasisbioRxiv - Microbiology 2021Quote: The chromatin immunoprecipitation (ChIP) assays was performed using SimpleChIP® Enzymatic Chromatin IP Kit (Magnetic Beads) (Cell Signaling Technologies, Inc., MA, US) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: The chromatin immunoprecipitation assay was performed as previously reported using the SimpleChIP Enzymatic Chromatin IP Kit (Cell Signaling Technology, Cat No. 9003)47 ...
-
bioRxiv - Neuroscience 2024Quote: 200,000 primary NSCs either stimulated with IL1α (10ng/ml) or left unstimulated were used for CUT&RUN assay using the CUT&RUN kit from Cell Signaling Technologies® #86652 according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... freshly prepared by trypsin-EDTA digestion were used to perform CUT&RUN with the CUT&RUN Assay Kit (catalog no. 86652, Cell Signaling Technology), according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... We incubated the cell lysates with Phospho-YAP (Ser397) rabbit antibody and performed a sandwich-ELISA assay by using PathScan Phospho-YAP (Ser397) Sandwich ELISA Kit (Cell Signaling Technology, #57046). We then used a Synergy HTX Multi-Mode Reader (BioTek ...
-
bioRxiv - Cell Biology 2023Quote: ... Cellular lysates from FLSs were harvested and a ChIP assay was performed using the SimpleChIP® Plus Enzymatic Chromatin IP Kit (9005, Cell Signaling Technology). In brief ...
-
bioRxiv - Molecular Biology 2024Quote: Senescence-associated beta-galactosidase in HSVSMC lysates was quantified using the Senescence β-Galactosidase Activity Assay Kit (Fluorescence, Plate-Based) (Cell signaling Technology). Measurement was done on cell lysates with the same total protein concentration ...
-
bioRxiv - Cell Biology 2020Quote: Senescence-associated β-galactosidase assays (Cell Signaling) were performed as per manufacturer’s instructions before manually counting positive cells Acidic organelles were detected using Lysotracker Deep Red (ThermoFisher ...
-
bioRxiv - Genomics 2020Quote: ... Senescence-associated β-galactosidase assay (Cell Signaling) was performed according to the manufacturer’s instructions to evaluate the fraction of positively-stained cells at different passages ...
-
bioRxiv - Cancer Biology 2023Quote: ... The following antibodies were used in the assay: anti-OCT4 antibody (15 μL/assay, #2750; Cell Signaling Technology, Danvers, MA) and Rabbit (DA1E ...
-
bioRxiv - Bioengineering 2022Quote: ... Senescence-associated β-Galactosidase assay (Cell Signaling, #9860S) was performed and quantified as previously described ...
-
bioRxiv - Cancer Biology 2020Quote: Cells treated for 48 h with NaB were lysed with a lysis solution buffer and acetylation of H3 was measured with PathScan® Acetylated Histone H3 Sandwich enzyme-linked immunosorbent assay (ELISA) Kit (Cell Signaling Technology, Danvers, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 1× radioimmunoprecipitation assay (RIPA) buffer (Cell Signaling; Cat# 501015489) containing 1× protease inhibitor cocktail (Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: ChIP assays were performed using: anti-Suz12 (3737; Cell Signaling Technology), anti-Ring1b (homemade ...
-
bioRxiv - Molecular Biology 2020Quote: ... Lysis buffers for ChIP assays were purchased from Cell Signaling Technology, USA (SimpleChIP® Enzymatic Cell Lysis Buffers A & B ...
-
bioRxiv - Developmental Biology 2021Quote: The procedure for standard ChIP assay using Ezh2 (Cell Signaling, #9346) and H3K27me antibody (ChIP grade from Cell Signaling ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were normalized by bicinchoninic acid (BCA) assay (Cell Signaling, 7780), and loaded on a precast SDS-PAGE gel (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were normalized by bicinchoninic acid (BCA) assay (Cell Signaling, 7780), and loaded on a precast SDS-PAGE gel (Bio-Rad ...
-
bioRxiv - Developmental Biology 2021Quote: ... The procedure for standard ChIP assay using H3K27me3 and Ezh2 (Cell Signaling) antibodies was described previously (Chen et al ...
-
bioRxiv - Cancer Biology 2019Quote: Rho activity was assessed using the Rho Activity assay from Cell Signaling (#8820 ...
-
bioRxiv - Neuroscience 2023Quote: ... Immunoblot assays against specific neuronal markers β3-Tubulin (Cell Signaling Technology, 5568) permitted to assess the purity of cell cultures.
-
bioRxiv - Genetics 2021Quote: ... The antibodies used in ChIP assays were: H3K4Me3 (C42D8, #9751, Cell Signaling Technologies), H3K27Ac (ab45173 ...
-
bioRxiv - Cancer Biology 2019Quote: The ChIP assay was performed according to the manufacturer’s instructions (Cell Signaling Technology). Anti-N1ICD (Cell Signaling Technology 1:200 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The antibodies used for this assay were: BRCA2 (Cell Signaling Technology, CATCAT# 10741), β-TUBULIN (Cell Signaling Technology ...
-
bioRxiv - Physiology 2023Quote: ... The gel supershift assay was performed by adding p-65 antibody (Cell Signaling) prior to the addition of the fluorescently labeled probe ...
-
bioRxiv - Neuroscience 2024Quote: ... The ChIP assay was performed using control IgG (Cell Signaling Technology, Cat. 3900) or anti-YAP1 antibody (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2022Quote: ... or both and lysed in radioimmunoprecipitation assay (RIPA) buffer (Cell Signaling Technology, Danvers, MA) supplemented with protease and phosphatase inhibitors (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... Assay results were analyzed by western blot with Anti-ERK (Cell signaling technology, #9102) and pERK(Cell signaling technology ...
-
bioRxiv - Cancer Biology 2021Quote: ... The following siRNAs were used for functional assays: siRNA FYN#1 (Cell Signaling Technology #12473), siRNA FYN#2 5’GGCCCTTTATGACTATGAATT3’ ...
-
bioRxiv - Pathology 2022Quote: ... and pull-down assays include monoclonal rabbit α-Notch1 (3608S; Cell Signaling Technology, Danvers MA), polyclonal rabbit α-Notch1 ...
-
bioRxiv - Cell Biology 2022Quote: SA-β-Gal enzymatic activity assay was performed following the manufacturer’s instructions (Cell Signaling Technology). Briefly ...
-
bioRxiv - Cancer Biology 2024Quote: EOC cell lines were lysed in 1x radioimmunoprecipitation assay buffer (RIPA, Cell Signaling Technology, BioConcept) containing a proteinase inhibitor cocktail (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: A BrdU cell proliferation assay was conducted according to the supplier’s instructions (Cell signaling, Danvers, MA). Briefly ...
-
bioRxiv - Genomics 2023Quote: ... The senescent state of the cells was addressed by senescence-associated β-galactosidase assay (Cell Signaling) according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2021Quote: ... Tendons were homogenized in radioimmunoprecipitation assay (RIPA) buffer with protease/phosphatase inhibitors (Cell Signaling Technology [CST] #58725) using 0.5-mm zirconium oxide beads and a Bullet Blender Gold Cell Disrupter (Next Advance Inc.) ...
-
Convergent evolution of distinct immune sensor systems for fungal polygalacturonases in BrassicaceaebioRxiv - Plant Biology 2020Quote: ... MAPK activity assay was performed by immunoblotting with anti-phospho p44/42 MAP kinase antibody (Cell Signaling Technology). For gene expression assays ...
-
bioRxiv - Cell Biology 2022Quote: Exosomes isolated by ultracentrifugation were lysed in equal volume of radio-immunoprecipitation assay (RIPA) buffer (Cell Signaling Technology) containing protease inhibitor cocktail (Cell Signaling Technology ...
-
bioRxiv - Developmental Biology 2020Quote: ... Immunofluorescence assays were performed with the following primary antibodies: anti-Trx-1 (1:50, Cat# 24295, Cell Signaling) and anti-eGFP (1:400 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Rabbit (DA1E) mAb IgG XP® Isotype Control (15 μL/assay, #66362; Cell Signaling Technology, Danvers, MA). DNA obtained from the CUT&RUN assay was amplified using SYBR Green qRT-PCR with the StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Antibodies for western blots and co-immunoprecipitation assays were anti-phospho-p44/42 MAPK (Cell Signaling, Technology, 9101), anti-p44/42 MAPK (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2022Quote: ... Kit (Cell Signaling Technology, 3074), Ido1 (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2022Quote: Protein samples were collected and lysed using a radioimmunoprecipitation assay buffer containing protease and phosphatase inhibitors (Cell Signaling Technology). Lysates were quantified by Bradford assay (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Phospho-KIT (Try719) (#3391; Cell Signaling), Green Fluorescent Protein (AB3080P ...