Labshake search
Citations for Jena Bioscience :
1 - 50 of 73 citations for Mouse Angiotensin III Ang III CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The mouse anti-dsRNA antibody (J2) was from Jena Bioscience and rabbit anti-Calnexin from Elabscience ...
-
bioRxiv - Cell Biology 2023Quote: ... Mouse anti-dsRNA J2 (1:100, RNT-SCI-10010200; Jena Bioscience), sheep anti-SARS-CoV-2 nsp3 (1:200 ...
-
bioRxiv - Genomics 2023Quote: ... This PCR product (1.5 µg) was then labeled using the Nick Translation kit from Jena Bioscience (AF555 NT Labeling Kit). For the M ...
-
bioRxiv - Genomics 2020Quote: ... with a nick translation labelling kit (Jena Bioscience).
-
bioRxiv - Cell Biology 2022Quote: ... Total RNA Purification kit was from Jena Biosciences, Jena ...
-
bioRxiv - Cancer Biology 2021Quote: ... or the Digoxigenin NT Labeling Kit (Jena Bioscience). Hybridization was carried out in a humidified chamber at 37°C for 16 h ...
-
bioRxiv - Microbiology 2020Quote: ... ATP Affinity kit (no. AK-102, Jena Biosciences).
-
bioRxiv - Evolutionary Biology 2022Quote: ... male and female gDNA was labelled by nick translation with Cy3 NT Labeling Kit and Fluorescein NT Labeling Kit (Jena Bioscience), respectively ...
-
bioRxiv - Molecular Biology 2022Quote: ... the qPCR Green Core kit (Jena Biosciences, PCR-333L) or the GoTaq® qPCR kit (Promega ...
-
bioRxiv - Genomics 2021Quote: ... Probe labelling was carried out by Nick-translation (AF594 NT Labeling Kit, PP-305L-AF594; AF488 NT Labeling Kit, PP-305L-AF488; respectively; Jena Bioscience, Jena, Germany). Slides were counterstained in 12 μl of Vectashield Antifade Mounting Medium with DAPI (H-1200 ...
-
bioRxiv - Genetics 2023Quote: ... The probes were obtained by direct labeling of the bacterial DNA (1.5 μg) using the Nick Translation kit from Jena Bioscience (Atto488 NT Labeling Kit), the labeling reaction was performed at 15°C for 90 min ...
-
bioRxiv - Genomics 2023Quote: ... mycoides probe was obtained by direct labeling of the bacterial DNA (1.5 µg) using the Nick Translation kit from Jena Bioscience (Atto488 NT Labeling Kit). For the 2µ plasmid labeling ...
-
bioRxiv - Genomics 2021Quote: ... as FISH probes using nick translation labelling kits (Jena Bioscience). Before hybridization ...
-
bioRxiv - Microbiology 2024Quote: ... The following primary antibodies were diluted 1:400 in blocking buffer and incubated over night at 4°C: mouse anti-dsRNA J2 (RNT-SCI-10010200; Jena bioscience), mouse anti-DDX5 (67025 Proteintech ...
-
bioRxiv - Cancer Biology 2021Quote: To fluorescently label IVT RNA the ATTO647N RNA labelling kit (Jena Bioscience) was used ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was isolated using the Total RNA Purification Kit (Jena Biosciences) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... primer extension was performed using the DNA cycle sequencing kit (Jena Bioscience), 150 ng digested DNA and 32P-end-labelled oligonucleotides according to the manufacturer protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Atto488 or Atto550 fluorophores by a nick translation labelling kit (Jena Bioscience).
-
bioRxiv - Microbiology 2023Quote: ... A sequencing ladder was generated using the DNA Cycle Sequencing kit (Jena Bioscience) according to the manufacturer’s recommendations with the CJnc230 sRNA region amplified from NCTC11168 WT (CSS-5295 ...
-
bioRxiv - Microbiology 2019Quote: The Click Chemistry labelling system “CuAAC Biomolecule Reaction Buffer Kit (THPTA based)” (Jena Bioscience) was used following manufacturer’s instructions [51] ...
-
bioRxiv - Microbiology 2020Quote: ... A DNA sequencing ladder was generated using a DNA cycle Sequencing Kit (Jena Bioscience) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... A sequencing ladder was also constructed using the DNA Cycle sequencing kit (Jena Bioscience) according to the manufacturer’s instructions with the CJnc180/190 region amplified with primers CSO-0354/0355 from genomic DNA (NCTC11168 wild-type ...
-
bioRxiv - Molecular Biology 2023Quote: ... for GTP analog treated samples Non-hydrolyzable GTP Test Kit (Jena Bioscience #NK-102) containing 5 analogs – GTPαS ...
-
bioRxiv - Molecular Biology 2022Quote: ... we performed click chemistry using the CuAAC Biomolecule Reaction Buffer Kit-BTTAA based (Jena Biosciences). Following click chemistry ...
-
bioRxiv - Plant Biology 2024Quote: ... The Cy5 probe was generated using the HighYield T7 Cy5 RNA Labelling Kit (Jena Bioscience) with a T7-gfp PCR product as template ...
-
bioRxiv - Immunology 2024Quote: ... Immunostaining was performed in four steps to avoid unspecific binding of the secondary antibodies: i) incubation overnight at 4LJ with the mouse monoclonal IgG2a J2 antibody anti-dsRNA (Jena Bioscience, cat. RNT-SCI-10010500, dilution 1:200), ii ...
-
bioRxiv - Plant Biology 2019Quote: Fluorescent labeling of dsRNA was performed using the Atto 488 RNA Labeling Kit (Jena Bioscience, Jena, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... dUTP-ATTO-550 or dUTP-ATTO-488 using a nick translation labelling kit (Jena Bioscience, http://www.jenabioscience.com).
-
bioRxiv - Molecular Biology 2021Quote: ... 4 samples each) were extracted with CHAPS Lysis buffer from the Click Chemistry Capture Kit (Jena Bioscience). Input cell numbers were adjusted to give similar amount of total injected peptides ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA from each clone was labeled through nick translation with either the Atto550 NT Labeling Kit (Jena Bioscience) or the Digoxigenin NT Labeling Kit (Jena Bioscience) ...
-
bioRxiv - Plant Biology 2021Quote: Fluorescence labeling of SaMIF1-dsRNA was performed using the HighYield T7 AF488 RNA Labeling Kit (Jena Bioscience, Germany) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: C15-az and C17-az modified proteins were pulled down using the Click Chemistry Capture Kit (Jena Bioscience) and alkyne agarose beads (Jena Bioscience) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... probes were labelled by nick translation with Cy3-dUTP using Cy3 NT Labeling Kit (Jena Bioscience, Jena, Germany). In this case ...
-
bioRxiv - Genomics 2019Quote: ... 1ug phosphorylated oligo was incubated with reagents from the CuAAC Biomolecule Reaction Buffer kit (Jena Bioscience CLK-072) and 250uM azide for 1h at 37C ...
-
bioRxiv - Molecular Biology 2021Quote: ... in vitro transcription was performed using the HighYield T7 Cy3 RNA Labelling Kit (Jena Bioscience, RNT-101-CY3) in accordance to the instructions of the manufacturer ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: Random mutagenesis was carried out in a 50 µl reaction with the JBS dNTP-Mutagenesis Kit (Jena Bioscience) with 5 µM dNTP analogs ...
-
bioRxiv - Systems Biology 2023Quote: ... followed by column purification (Zebaspin RNA clean&concentrator kit) and subsequent coupling to DBCO-PEG12-TCO (Jena Biosciences) at 1:5 molar ratio overnight at room temperature ...
-
bioRxiv - Genetics 2023Quote: ... The entire plasmids were labeled by nick translation using a Cy3 NT Labeling Kit (Jena Bioscience, Jena, Germany). For the final probe mixture preparation ...
-
bioRxiv - Genetics 2021Quote: ... the PCR labelling Cy-3 and Cy-5 kits (Jena Bioscience, ref# PP-301L-Cy3 and #APP-101-Cy5) according to the manufacturer’s instructions with M13 universal primers ...
-
bioRxiv - Biochemistry 2020Quote: ... affinity chromatography of CDPK1 pre-incubated with the compounds was performed by utilizing ATP Affinity Test Kit (Jena Bioscience). Protocol was followed as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2019Quote: All PCR products with the expected size were purified using the SAP-Exo Kit (Jena Bioscience GmbH, Jena, Germany) and Sanger sequenced from both directions by LGC Genomics (Berlin ...
-
bioRxiv - Systems Biology 2022Quote: ... All cell stocks were regularly checked for absence of mycoplasma with the Mycoplasma Detection Kit (Jena Bioscience; # PP-401).
-
bioRxiv - Genomics 2023Quote: ... Mycoplasma was tested to be negative for all cellular input reported using Mycoplasma Detection Kit (Jena Bioscience PP-401) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: Cell lines are regularly checked for the absence of Mycoplasma using a PCR based detection kit (Jena Biosciences PP-401).
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were tested at least once in two months for Mycoplasma contamination using Mycoplasma Detection Kit (Jena Bioscience PP-401L).
-
bioRxiv - Evolutionary Biology 2023Quote: ... In-vitro transcription was conducted with HighYield T7 Cap 1 AG (3‘-OMe) mRNA Synthesis Kit (m5CTP) (Jena Bioscience, Germany) using 800 ng of amplified template followed by Turbo DNase treatment (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... mESCs were checked once during cultivation for Mycoplasma contamination using a PCR-based mycoplasma detection kit (Jena Bioscience #PP-401L) as indicated by the manufacturer.
-
bioRxiv - Molecular Biology 2024Quote: ... In vitro transcription was performed using a T7-Scribe Standard RNA IVT Kit (CELLSCRIPT) in the presence of 1.2 mM BrUTP (Jena Bioscience) and 5 mM UTP ...
-
bioRxiv - Molecular Biology 2024Quote: ... In vitro transcription was performed using a T7-Scribe Standard RNA IVT Kit (CELLSCRIPT) in the presence of 1.2 mM BrUTP (Jena Bioscience) and 5 mM UTP ...
-
bioRxiv - Molecular Biology 2021Quote: T7 promoter containing double stranded DNA was used as a template for in vitro transcription with HighYield T7 mRNA Synthesis Kit (ac4CTP) (Jena Bioscience) (sense strand 5’ GTACGGTAATACGACTCACTATAGGGAGTGGTCTACACACATGACAGAATGGGGCAGGTCCGTAATCGGTTGCAGAGCGGTTACCGATCTCATCGC 3’ and antisense strand 5’ GGCCGCGATGAGATCGGTAACCGCTCTGCAACCGATTACGGACCTGCCCCATTCTGTCATGTGTGTAGACCACTCCCTATAGTGAGTCGTATTACC 3’) ...