Labshake search
Citations for Jena Bioscience :
201 - 243 of 243 citations for Mono 3 Carboxypropyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Cells migrating in microfluidic devices were pulsed with 1 mM 5-ethynyl uridine (EU, Jena Bioscience) in complete DMEM for 4 hours ...
-
bioRxiv - Genomics 2021Quote: ... 1 μL of 0.05 mM 7-propargylamino-7-deaza-ddATP-6-FAM (Jena Bioscience, Jena, Germany), 0.4 μL of internal standard solution (see Supplementary Methods) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The sample-covered carbon was then adsorbed to an EM grid (Quantifoil R3.5/1, Jena Bioscience) and blotted for 9 s using a Vitrobot Mark IV (ThermoFisher ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified by PCR in the presence of 1:5 Digoxigenin-11-dUTP:dTTP (Jena Bioscience, Germany) using primers CD21 and CD26 (Supplementary Table 1) ...
-
bioRxiv - Plant Biology 2022Quote: ... Prepared samples were mixed with Regeneration agar containing nourseothricin (300 μg.ml-1, Jena BioScience, pNDN-OGG) or hygromycin (100 μg.ml-1 ...
-
bioRxiv - Biophysics 2023Quote: ... pH 7.4) with 1 mM guanosine-5’-[(α,β)-methyleno]triphosphate (GMPCPP; NU-405S, Jena Bioscience) and the solution was incubated for 30 min at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1% Igepal CA-630) after which a click reaction was performed with Sulfo-Cy5-Azide (Jena Bioscience) at the following concentrations ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 % CO2 for 1 h after a final concentration of 500 µM 5-Ethynyluridine (5EU, Jena Bioscience) was added ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 µM P7/P8 and either 50 µM oxo- dGTP or 1 µM dPTP (Jena Bioscience, Germany). PCR products were DpnI digested for 1 h and 37°C and 5 ng of each product were used for a second PCR ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we added all four nucleotides at a final concentration of 1 µM (Biotin-7-dATP, Jena Biosciences, and dC-Atto647N or dU-Atto488 ...
-
bioRxiv - Biophysics 2021Quote: ... Double cycle GMPCPP polymerisation was performed as follows: reconstituted tubulin was supplemented with 1 mM GMPCPP (Jena Biosciences) and incubated for 5 mins on ice ...
-
bioRxiv - Immunology 2020Quote: ... Vero E6 cells were incubated with a 1:500 dilution of an anti-dsRNA J2 antibody (Jena Bioscience) in PBS supplemented with 1% FCS at 4°C overnight with shaking ...
-
bioRxiv - Biochemistry 2023Quote: ... and GDPCP was assembled in 1×10 buffer by preincubation of eEF1A and GDPCP (Jena Bioscience, Jena, Germany) for 5 minutes at 30°C followed by addition of Ala-tRNAAla for 1 minute at 30°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Endogenous and overexpressed PML was immunofluorescently labelled with anti-PML antibody (rabbit, ABD-030, Jena Bioscience, Germany, 1:500), followed by secondary antibody coupled with STAR 580 STED dye (goat-anti-rabbit ...
-
bioRxiv - Cell Biology 2022Quote: ... Single-strand cDNA synthesis was carried out with 1 mg of total RNA using SCRIPT Reverse Transcriptase (Jena Bioscience). qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2023Quote: ... washed extensively with the loading buffer and eluted with the loading buffer supplemented with 1 mM m7GTP (Jena Bioscience). Input ...
-
bioRxiv - Cell Biology 2021Quote: ... 10% Biotinalyted and 65% unlabelled) was polymerised in the presence of 1 mM GMPCPP (NU-405 Jena BioScience, Jena, Germany) at 37 °C for 30 min ...
-
bioRxiv - Biochemistry 2021Quote: ... and DEPTOR (6.8 μM) were preincubated in the presence of 1 mM MgCl2 and 500 μM AMP-PNP (Jena Biosciences) for 20 min and used for cryo-EM grid preparation.
-
bioRxiv - Biochemistry 2021Quote: ... cells were labelled for 20 minutes with EU (5-ethynyl uridine, Jena Bioscience CLK-N002, final concentration at 1 mM). Harvested cells were firstly labeled with Zombie AquaTM (BioLegend ...
-
bioRxiv - Microbiology 2022Quote: ... were prepared for the MluCI and HpaII-digested DNA with mixes were prepared containing 1× ligation buffer (50 mM Tris-HCl pH 7.4 (Jena Bioscience), 10 mM MgCl2 (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2022Quote: ... 150 mM NaCl and time-lapse images were acquired while flowing in 0.3 μM dynamin mixed with 1 mM GTP (Jena Bioscience) and 1 mM MgCl2 in 20 mM HEPES pH 7.4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 68% unlabelled tubulin) for 1 h at 37 ֯C in BRB80 supplemented with 2.7 mM GMPCPP (Jena Bioscience, NU-405). The polymerized microtubules were centrifuged for 30 min at 18000 x g in a Microfuge 18 Centrifuge (Beckman Coulter) ...
-
bioRxiv - Genomics 2024Quote: ... and fragment ends filled-in and biotinylated by adding 27.5 µl of a cocktail containing 15 µL 1 mM biotin-14-dUTP (Jena BioScience), dCTP ...
-
bioRxiv - Biophysics 2021Quote: ... MTs were prepared either with 0.75 µM mung tubulin or 30 µM goat brain tubulin in BRB-80 buffer with 1 mM GMPCPP (Jena Bioscience, Germany) and incubated at 37°C for 60 min ...
-
bioRxiv - Microbiology 2020Quote: ... The assay was carried out at 37°C and the reaction was started by addition of 1 mM pppGpp (Jena Bioscience), and samples for the nucleotide measurement were taken after 15 min ...
-
bioRxiv - Biochemistry 2020Quote: ... Additives as indicated were added during the primary antibody incubation step at a final concentration of 1 µM for adenosine (Jena Bioscience), AMP (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2020Quote: ... purified naïve C57BL/6 B2 cells were preincubated with a mixture of NIP-OVA and HIV-1 p17/p24/gp120 fusion protein (Jena Biosciences) covalently bound to 1 μm beads (1:1 bead:Bcell ratio ...
-
bioRxiv - Cell Biology 2020Quote: ... For synthesis of the 4sU-labeled spike-ins 1/10 of UTP in the transcription reactions was replaced with 4sUTP (Jena BioScience).
-
bioRxiv - Molecular Biology 2019Quote: ... GMPCPP-stabilized seeds were made by two rounds of polymerization in 25 µM tubulin (40% dig-tubulin) supplemented with 1 mM GMPCPP (Jena Biosciences) as described (Volkov et al. ...
-
bioRxiv - Physiology 2022Quote: ... glycoproteins were enriched using Concanavalin A and azido-modifed proteins were immobilized on magnetic DBCO-beads (Jena Bioscience #CLK-1037-1) via click chemistry ...
-
bioRxiv - Microbiology 2023Quote: ... 500 ng of RNA was reverse-transcribed with gene specific primers (Supplementary information 1) using the SCRIPT cDNA Synthesis Kit (Jena Bioscience) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: On-gel mito-FUNCAT was performed as described previously.72,114 HeLa S3 and MPV17L2 KO #1 cells were cultured in 6-well plates in methionine-free medium with 50 µM HPG (Jena Bioscience) and 100 µg/ml anisomycin (Alomone Labs ...
-
bioRxiv - Biochemistry 2023Quote: ... The chamber was pre-equilibrated with an oxygen scavenger cocktail 32 in 20 mM HEPES pH 7.4 with 150 mM NaCl and time-lapse images were acquired while flowing desired proteins in the same buffer in the absence or presence of 1 mM GTP (Jena Bioscience) and 1 mM MgCl2.
-
bioRxiv - Microbiology 2024Quote: ... The following primary antibodies were diluted 1:400 in blocking buffer and incubated over night at 4°C: mouse anti-dsRNA J2 (RNT-SCI-10010200; Jena bioscience), mouse anti-DDX5 (67025 Proteintech ...
-
bioRxiv - Biophysics 2021Quote: ... GMPCPP seeds were prepared by polymerizing a 1:4 molar ratio of TAMRA labelled:unlabelled tubulin in the presence of guanosine-5’-[(α, β)-methyleno]triphosphate (GMPCPP, Jena Biosciences) in two cycles ...
-
bioRxiv - Biochemistry 2021Quote: ... RHEB was preincubated for 1 h with a 30-fold molar excess of GTPγS (Jena Bioscience NU-412-20, lot IT008-18). Next ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then washed again 3x in 1xPBS and then incubated with 5 µM DBCO-488 (Jena Bioscience, CLK-1278-1) at 37 °C for 30 min or 5 µM Click-IT Alexa Fluor® 488 DIBO alkyne dye (ThermoScientific ...
-
bioRxiv - Biochemistry 2023Quote: ... the sequence of corresponding constructs of proLEG were cloned into pLEXSY-sat2.1 vectors and transfected into LEXSY P10 host strain of Leishmania tarentolae cells of the LEXSYcon2.1 expression system (Jena Biosciences, Jena, Germany). The resulting constructs carried N-terminal His6-tags and an N-terminal signal sequence for secretion into the supernatant ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we added all four nucleotides at a final concentration of 1 µM (Biotin-7-dATP, Jena Biosciences, and dC-Atto647N or dU-Atto488, Jena Biosciences with respective pair of unmodified nucleotides ...
-
bioRxiv - Cell Biology 2019Quote: ... fluorescently labelled and non-labelled tubulin in a ratio 18:12:70 (total of 20 μM tubulin) with 1 mM GMPCPP (NU-405 Jena BioScience, Jena, Germany) at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... and GTP or GDPCP were assembled in 1×10 buffer with 10 mM βME by preincubation of eEF1A and GTP (PromegaTM Corp., Madison, WI) or GDPCP (Jena Bioscience, Jena, Germany) for 5 minutes at 37°C followed by addition of tRNAAla or Ala-tRNAAla for 1 minute at 37°C and were then kept on ice until use ...
-
bioRxiv - Biochemistry 2023Quote: ... All exchange experiments reported in this article were initiated by incubation of G-actin (1 µM) with N6-(6-Amino)hexyl-ATP-ATTO-488 (0.1 µM; Jena Bioscience, Germany, ref. NU-805-488) in G+ME buffer (5mM Tris pH 7.5 ...
-
bioRxiv - Immunology 2024Quote: ... Immunostaining was performed in four steps to avoid unspecific binding of the secondary antibodies: i) incubation overnight at 4LJ with the mouse monoclonal IgG2a J2 antibody anti-dsRNA (Jena Bioscience, cat. RNT-SCI-10010500, dilution 1:200), ii ...