Labshake search
Citations for Jena Bioscience :
151 - 200 of 262 citations for 7 chloro 1 2 diethylamino ethyl 5 2 fluorophenyl 1 3 dihydro 2H benzo 1 4 diazepin 2 one monohydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... crescentus ParBΔCTD-CTPɣS complex crystal were also set up in sitting-drop vapour diffusion format in MRC2 96-well crystallization plates with drops comprised of 0.3 µL precipitant solution and 0.3 µL of protein solution (∼10 mg/mL) supplemented with 1 mM CTPɣS (Jena Biosciences) and 1 mM MgCl2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 μl of 40 μM PE* primer and 0.8 μl of 100 μM EvaGreen Fluorescent DNA Stain (Jena Bioscience). The reactions were amplified in a CFX96 Real-Time PCR instrument (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... Single-strand cDNA synthesis was carried out with 1 mg of total RNA using SCRIPT Reverse Transcriptase (Jena Bioscience). qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2023Quote: ... washed extensively with the loading buffer and eluted with the loading buffer supplemented with 1 mM m7GTP (Jena Bioscience). Input ...
-
bioRxiv - Cell Biology 2021Quote: ... 10% Biotinalyted and 65% unlabelled) was polymerised in the presence of 1 mM GMPCPP (NU-405 Jena BioScience, Jena, Germany) at 37 °C for 30 min ...
-
bioRxiv - Biochemistry 2021Quote: ... and DEPTOR (6.8 μM) were preincubated in the presence of 1 mM MgCl2 and 500 μM AMP-PNP (Jena Biosciences) for 20 min and used for cryo-EM grid preparation.
-
bioRxiv - Microbiology 2022Quote: ... were prepared for the MluCI and HpaII-digested DNA with mixes were prepared containing 1× ligation buffer (50 mM Tris-HCl pH 7.4 (Jena Bioscience), 10 mM MgCl2 (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2022Quote: ... 150 mM NaCl and time-lapse images were acquired while flowing in 0.3 μM dynamin mixed with 1 mM GTP (Jena Bioscience) and 1 mM MgCl2 in 20 mM HEPES pH 7.4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 68% unlabelled tubulin) for 1 h at 37 ֯C in BRB80 supplemented with 2.7 mM GMPCPP (Jena Bioscience, NU-405). The polymerized microtubules were centrifuged for 30 min at 18000 x g in a Microfuge 18 Centrifuge (Beckman Coulter) ...
-
bioRxiv - Genomics 2024Quote: ... and fragment ends filled-in and biotinylated by adding 27.5 µl of a cocktail containing 15 µL 1 mM biotin-14-dUTP (Jena BioScience), dCTP ...
-
bioRxiv - Biochemistry 2024Quote: ... Then, 0.9 ml of turbo DNase solution (15 mM MgSO4, 10 µg ml−1 turbo DNase (Jena Bioscience, EN-180), 1 mM TCEP and 0.5 mM phenylmethanesulfonyl fluoride ...
-
bioRxiv - Biophysics 2021Quote: ... MTs were prepared either with 0.75 µM mung tubulin or 30 µM goat brain tubulin in BRB-80 buffer with 1 mM GMPCPP (Jena Bioscience, Germany) and incubated at 37°C for 60 min ...
-
bioRxiv - Microbiology 2020Quote: ... The assay was carried out at 37°C and the reaction was started by addition of 1 mM pppGpp (Jena Bioscience), and samples for the nucleotide measurement were taken after 15 min ...
-
bioRxiv - Biochemistry 2020Quote: ... Additives as indicated were added during the primary antibody incubation step at a final concentration of 1 µM for adenosine (Jena Bioscience), AMP (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2020Quote: ... purified naïve C57BL/6 B2 cells were preincubated with a mixture of NIP-OVA and HIV-1 p17/p24/gp120 fusion protein (Jena Biosciences) covalently bound to 1 μm beads (1:1 bead:Bcell ratio ...
-
bioRxiv - Cell Biology 2020Quote: ... For synthesis of the 4sU-labeled spike-ins 1/10 of UTP in the transcription reactions was replaced with 4sUTP (Jena BioScience).
-
bioRxiv - Molecular Biology 2019Quote: ... GMPCPP-stabilized seeds were made by two rounds of polymerization in 25 µM tubulin (40% dig-tubulin) supplemented with 1 mM GMPCPP (Jena Biosciences) as described (Volkov et al. ...
-
bioRxiv - Physiology 2022Quote: ... glycoproteins were enriched using Concanavalin A and azido-modifed proteins were immobilized on magnetic DBCO-beads (Jena Bioscience #CLK-1037-1) via click chemistry ...
-
bioRxiv - Microbiology 2023Quote: ... 500 ng of RNA was reverse-transcribed with gene specific primers (Supplementary information 1) using the SCRIPT cDNA Synthesis Kit (Jena Bioscience) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: On-gel mito-FUNCAT was performed as described previously.72,114 HeLa S3 and MPV17L2 KO #1 cells were cultured in 6-well plates in methionine-free medium with 50 µM HPG (Jena Bioscience) and 100 µg/ml anisomycin (Alomone Labs ...
-
bioRxiv - Biochemistry 2023Quote: ... The chamber was pre-equilibrated with an oxygen scavenger cocktail 32 in 20 mM HEPES pH 7.4 with 150 mM NaCl and time-lapse images were acquired while flowing desired proteins in the same buffer in the absence or presence of 1 mM GTP (Jena Bioscience) and 1 mM MgCl2.
-
bioRxiv - Molecular Biology 2022Quote: ... ≥95% purity for 3’-dGTP (Jena Bioscience)] and incubated 2 min at 37°C (to “chase,” and thereby to stabilize ...
-
bioRxiv - Molecular Biology 2022Quote: ... ≥95% purity for 3’-dGTP (Jena Bioscience)] and incubated 2 min at 37°C (to “chase” non-terminated complexes) ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 µM Picolyl-Alexa647-Azide (Jena Bioscience) and 80 µM ascorbic acid (Merck) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Additional 5-Ethynyl-uridine (5-EU) was purchased from Jena Bioscience (CLK-N002) and resuspended to an initial stock concentration of 400 mM in DMSO.
-
bioRxiv - Biochemistry 2021Quote: ... RHEB was preincubated for 1 h with a 30-fold molar excess of GTPγS (Jena Bioscience NU-412-20, lot IT008-18). Next ...
-
bioRxiv - Biochemistry 2023Quote: ... the sequence of corresponding constructs of proLEG were cloned into pLEXSY-sat2.1 vectors and transfected into LEXSY P10 host strain of Leishmania tarentolae cells of the LEXSYcon2.1 expression system (Jena Biosciences, Jena, Germany). The resulting constructs carried N-terminal His6-tags and an N-terminal signal sequence for secretion into the supernatant ...
-
bioRxiv - Developmental Biology 2023Quote: ... After two additional washes the Tn5 was added (1:100) in CUT&Tag med buffer (20 mM HEPES [pH 7.5] (Jena Bioscience, #CSS-511), 300 mM NaCl (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2019Quote: ... 4-thio-UTP (4SU, Jena Bioscience) or 6-thio-GTP (6SG ...
-
bioRxiv - Biophysics 2020Quote: ... and 3 mM GMPCPP (NU-405S, Jena Bioscience) was mixed on ice ...
-
bioRxiv - Cell Biology 2019Quote: ... fluorescently labelled and non-labelled tubulin in a ratio 18:12:70 (total of 20 μM tubulin) with 1 mM GMPCPP (NU-405 Jena BioScience, Jena, Germany) at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... and GTP or GDPCP were assembled in 1×10 buffer with 10 mM βME by preincubation of eEF1A and GTP (PromegaTM Corp., Madison, WI) or GDPCP (Jena Bioscience, Jena, Germany) for 5 minutes at 37°C followed by addition of tRNAAla or Ala-tRNAAla for 1 minute at 37°C and were then kept on ice until use ...
-
bioRxiv - Biochemistry 2022Quote: ... in the presence of [α-32P]UTP and 7 mM “anti-reverse” cap analog (m7,3’-OGpppG; Jena Bioscience). All radiolabeled RNAs were gel-purified ...
-
bioRxiv - Biochemistry 2019Quote: ... 3’ end-labelled using Aminoallyl-UTP-Cy5 (Jena Bioscience) incubated with TdT.
-
bioRxiv - Biochemistry 2023Quote: ... All exchange experiments reported in this article were initiated by incubation of G-actin (1 µM) with N6-(6-Amino)hexyl-ATP-ATTO-488 (0.1 µM; Jena Bioscience, Germany, ref. NU-805-488) in G+ME buffer (5mM Tris pH 7.5 ...
-
bioRxiv - Genetics 2019Quote: ... EdU was coupled to a cleavable biotin-azide linker (Azide-PEG(3+3)-S-S-biotin) (Jena Biosciences, Cat. No. CLK-A2112-10) using the reagents of the Click-it Kit (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... At least 1000 µg of the cell lysates were incubated with Sepharose beads coupled to 7-methylguanosine (m7GTP, Jena Biosciences). Input cell lysates were collected for western blot analysis while the remaining were incubated overnight with continuous rotation at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... 250-300 μg of protein lysate together with 30 μl of 7-methyl GTP-agarose beads (Jena bioscience #AC-141) were incubated for 90 min at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... One half was subjected to a click chemistry reaction with disulfo-Cy5-picolyl-azide (Jena Bioscience CLK-1177) for one hour ...
-
bioRxiv - Microbiology 2019Quote: ... 5-Tetramethylrhodamine-Alkyne (TAMRA-Alkyne; Jena Bioscience), Acetylene-PEG4-Biotin (Biotin-Alkyne ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mM AF647-Picolyl-azide (Jena Biosciences) and 10 mM sodium ascorbate (Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell lysates (500 mg of protein) were incubated with 50 μl of 7-methyl-GTP-Agarose slurry (Jena Biosciences, AC-155S) for 16 h at 4 °C ...
-
bioRxiv - Immunology 2020Quote: ... and 4 mM of each ribonucleotide triphosphate (Jena Bioscience) and incubated at 37 °C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... Proteins were purified with 4% Glutathione Agarose (Jena Biosciences) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: 3’-(O-Propargyl)-ATP (NU-945) was offered by Jena Biosciences. To complete the set ...
-
bioRxiv - Cell Biology 2019Quote: ... nascent RNA was labelled by incubating the cells with 400 μM 5-ethynyluridine (5-EU; Jena Bioscience; CLK-N002-10,), which was then visualized with a click-iT mix consisting of 50mM Tris buffer pH8 ...
-
bioRxiv - Immunology 2024Quote: ... Immunostaining was performed in four steps to avoid unspecific binding of the secondary antibodies: i) incubation overnight at 4LJ with the mouse monoclonal IgG2a J2 antibody anti-dsRNA (Jena Bioscience, cat. RNT-SCI-10010500, dilution 1:200), ii ...
-
bioRxiv - Plant Biology 2019Quote: ... 5-Ethynyl-UTP was purchased from Jena Bioscience. A fraction of the reaction was analyzed using a standard agarose gel ...
-
bioRxiv - Biochemistry 2020Quote: ... 5’-guanylyl imidodiphosphate (GDPNP; Jena Bioscience NU-401-50) was added to the wells 16 minutes after the start of the reaction for five minutes at a concentration of 100uM followed by a five-minute pretreatment of either 208uM emetine (Cayman Chemical 21048 ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 mM ATP (Jena Biosciences; NU-1010-SOL)) supplemented with 220 nM Sytox Orange at 100 μl/min ...