Labshake search
Citations for Jena Bioscience :
101 - 150 of 209 citations for 7 Bromo 1 2 3 4 tetrahydronaphthalen 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: 3’-(O-Propargyl)-ATP (NU-945) was offered by Jena Biosciences. To complete the set ...
-
bioRxiv - Cell Biology 2019Quote: ... The tubulin mix (20 μM) with 1 mM GMPCPP (NU-405L; Jena Bioscience) in BRB80 (80 mM Pipes pH 6.9 ...
-
bioRxiv - Microbiology 2022Quote: ... and 1× TranscriptAid enzyme mix and 6 mM cap analog m7GpppG (Jena Bioscience) or m7GpppA (prepared chemically according to a published protocol40) ...
-
bioRxiv - Biophysics 2023Quote: ... in the presence of 1 mM GMPCPP (NU-405L, Jena Bioscience, Jena, Germany) was prepared at 37 °C to nucleate short microtubule seeds ...
-
bioRxiv - Biophysics 2024Quote: ... 1 MgCl2 and labeled in 300 nM of pyrimidyl-tetrazine-Alexa647 (JENA Biosciences) for 15-20 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 mM GTP (Jena Bioscience, NU-1047), 250 μg/ml glucose oxidase (Serva ...
-
bioRxiv - Biophysics 2023Quote: ... using an ATP (2 mM, Jena Bioscience) regenerating system containing NADH (0.2 mM ...
-
bioRxiv - Cell Biology 2019Quote: ... at a total tubulin concentration of 20 µM with 1 mM GMPCPP (Jena Biosciences) at 37° C for 30 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... nascent peptides within mitochondria were labeled with 1 μM azide-conjugated Cy3 (Jena Bioscience) with a Click-it Cell Reaction Buffer Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2021Quote: ... For labeling pCp-Cy5 (Cytidine-5’-phosphate-3’-(6-aminohexyl)phosphate (Jena bioscience), was ligated to the 3’ end of the 16 nt RNA using T4 RNA ligase (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: The in vitro transcribed RNAs were 3’ biotinylated using pCp-Biotin (Jena Biosciences). Briefly ...
-
bioRxiv - Biochemistry 2023Quote: ... The pre-tRNAs were 3’ biotinylated with pCp-biotin (750 µM; Jena Bioscience) and T4 RNA ligase (2 units/µl) ...
-
bioRxiv - Biochemistry 2022Quote: ... 2’-deoxythymidine-5’-[α-thio]-triphosphate (dTTPαS) and 2’-deoxyguanosine-5’-[α-thio]-triphosphate (dGTPαS) were obtained from Jena Biosciences. N-methylanthraniloyl guanosine-5’-triphosphate (mant-GTP ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM THPTA (Jena Bioscience #CLK-1010-25), and 4 mM sodium ascorbate (Sigma #PHR1279 ...
-
bioRxiv - Microbiology 2021Quote: ... Bst 2.0 polymerase buffer (2 μl) (Jena Bioscience). The incubation temperature was varied from 60-65°C for 60 min ...
-
bioRxiv - Biophysics 2019Quote: ... at a total final tubulin concentration of 20 µM with 1 mM GMPCPP (Jena Biosciences) at 37°C for 30 minutes ...
-
bioRxiv - Biophysics 2020Quote: ... Tubulin solutions were mixed with 1 µl 10 mM GMP-CPP (#NU-405S, Jena Bioscience) on ice and incubated for 10 minutes to allow nucleotide exchange ...
-
bioRxiv - Molecular Biology 2021Quote: ... Ribosome–EF-G complexes were applied to EM grids (Quantifoil 3.5/1 μm, Jena Bioscience) covered with pre-floated continuous carbon ...
-
bioRxiv - Biochemistry 2022Quote: ... The first crystals were found in several solutions of JB Screen Classic 1 (Jena Bioscience); for example ...
-
bioRxiv - Immunology 2023Quote: ... 1 µg/ml of recombinant YF17D-DIII or TBEV-DIII (Jena Bioscience, PR-1450-S) was used ...
-
bioRxiv - Cancer Biology 2023Quote: ... The concentrated RHEB was then incubated with 1 mM GMPPNP (Jena Bioscience NU-401-50) for 60 min at 4 °C and the protein was flash frozen in liquid nitrogen and stored at -80 °C.
-
bioRxiv - Biochemistry 2022Quote: ... To assemble microtubules stabilized with guanylyl-(a,(3)-methylene-diphosphonate (GMP-CPP) (Jena Bioscience), tubulin was diluted to 2 mg/mL in BRB80 buffer supplemented with 0.5 mM GMP-CPP ...
-
bioRxiv - Microbiology 2023Quote: ... packed with 2 ml Ni-NTA agarose (Jena Bioscience) and equilibrated with 10 column volumes (CV ...
-
bioRxiv - Immunology 2023Quote: ... 10 μM EdU (5-ethynyl-2’-deoxyuridine, Jena Bioscience) was added to the cell culture medium for 10 min at the end of 72 h culture on anti-CD3ε- and anti-CD28-coated cell culture plates ...
-
bioRxiv - Cell Biology 2024Quote: ... employing 2 mM 6-FAM-dC-Puromycin (Jena Bioscience), according to Wang et al ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells migrating in microfluidic devices were pulsed with 1 mM 5-ethynyl uridine (EU, Jena Bioscience) in complete DMEM for 4 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 mg of azide coupled bivalent Nb was incubated with 0.5 mL DBCO-Agarose (Jena Bioscience) slurry for 4 h at 25 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The sample-covered carbon was then adsorbed to an EM grid (Quantifoil R3.5/1, Jena Bioscience) and blotted for 9 s using a Vitrobot Mark IV (ThermoFisher ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified by PCR in the presence of 1:5 Digoxigenin-11-dUTP:dTTP (Jena Bioscience, Germany) using primers CD21 and CD26 (Supplementary Table 1) ...
-
bioRxiv - Plant Biology 2022Quote: ... Prepared samples were mixed with Regeneration agar containing nourseothricin (300 μg.ml-1, Jena BioScience, pNDN-OGG) or hygromycin (100 μg.ml-1 ...
-
bioRxiv - Biophysics 2023Quote: ... pH 7.4) with 1 mM guanosine-5’-[(α,β)-methyleno]triphosphate (GMPCPP; NU-405S, Jena Bioscience) and the solution was incubated for 30 min at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... Female genomic probe was labelled with Cy3-dUTP (cyanine 3-deoxyuridine triphosphate; Jena Bioscience, Germany) by nick translation ...
-
bioRxiv - Biophysics 2023Quote: ... 50 mM each of Azide-(PEG)4-NHS (Jena Biosciences GmbH, Jena, Germany) and Methyl-(PEG)4-NHS (Life technologies ...
-
bioRxiv - Biophysics 2024Quote: ... 50 mM each of azide-(PEG)4-NHS (Jena Biosciences GmbH, Jena, Germany) and methyl-(PEG)4-NHS (Life technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1% Igepal CA-630) after which a click reaction was performed with Sulfo-Cy5-Azide (Jena Bioscience) at the following concentrations ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 % CO2 for 1 h after a final concentration of 500 µM 5-Ethynyluridine (5EU, Jena Bioscience) was added ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 µM P7/P8 and either 50 µM oxo- dGTP or 1 µM dPTP (Jena Bioscience, Germany). PCR products were DpnI digested for 1 h and 37°C and 5 ng of each product were used for a second PCR ...
-
bioRxiv - Biochemistry 2020Quote: ... 3’dGTP and cytidine-5’-[(α,β)-methyleno]triphosphate (CMPCPP) were from Jena Bioscience (Jena, Germany); 2’dGTP ...
-
bioRxiv - Biophysics 2022Quote: ... The 4 bp overhangs formed were filled in with biotin-11-dGTP (Jena Bioscience), biotin-16-dUTP (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.4 μM 5/6- TAMRA-PEG 4 -Alkyne (Jena Bioscience; Jena, Germany; CLK-TA108) and 0.2 mM freshly prepared CuSO4 in 1x PBS pH7.8 ...
-
bioRxiv - Biophysics 2021Quote: ... Double cycle GMPCPP polymerisation was performed as follows: reconstituted tubulin was supplemented with 1 mM GMPCPP (Jena Biosciences) and incubated for 5 mins on ice ...
-
bioRxiv - Immunology 2020Quote: ... Vero E6 cells were incubated with a 1:500 dilution of an anti-dsRNA J2 antibody (Jena Bioscience) in PBS supplemented with 1% FCS at 4°C overnight with shaking ...
-
bioRxiv - Plant Biology 2023Quote: ... then 5×106 cells were plated on ESAW agar plates containing 450 μg mL-1 nourseothricin (Jena Bioscience), and incubated in constant light at 18 °C.
-
bioRxiv - Biochemistry 2023Quote: ... and GDPCP was assembled in 1×10 buffer by preincubation of eEF1A and GDPCP (Jena Bioscience, Jena, Germany) for 5 minutes at 30°C followed by addition of Ala-tRNAAla for 1 minute at 30°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 uL of alkyne agarose slurry (Jena Bioscience #CLK-1032-2) was washed with IP buffer (1% CHAPS ...
-
bioRxiv - Neuroscience 2020Quote: ... Endogenous and overexpressed PML was immunofluorescently labelled with anti-PML antibody (rabbit, ABD-030, Jena Bioscience, Germany, 1:500), followed by secondary antibody coupled with STAR 580 STED dye (goat-anti-rabbit ...
-
bioRxiv - Microbiology 2021Quote: ... crescentus ParBΔCTD-CTPɣS complex crystal were also set up in sitting-drop vapour diffusion format in MRC2 96-well crystallization plates with drops comprised of 0.3 µL precipitant solution and 0.3 µL of protein solution (∼10 mg/mL) supplemented with 1 mM CTPɣS (Jena Biosciences) and 1 mM MgCl2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 μl of 40 μM PE* primer and 0.8 μl of 100 μM EvaGreen Fluorescent DNA Stain (Jena Bioscience). The reactions were amplified in a CFX96 Real-Time PCR instrument (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... Single-strand cDNA synthesis was carried out with 1 mg of total RNA using SCRIPT Reverse Transcriptase (Jena Bioscience). qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2023Quote: ... washed extensively with the loading buffer and eluted with the loading buffer supplemented with 1 mM m7GTP (Jena Bioscience). Input ...