Labshake search
Citations for Jena Bioscience :
151 - 200 of 210 citations for 7' BROMO 2' 3' DIHYDRO 1'H SPIRO CYCLOPROPANE 1 4' ISOQUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Endogenous and overexpressed PML was immunofluorescently labelled with anti-PML antibody (rabbit, ABD-030, Jena Bioscience, Germany, 1:500), followed by secondary antibody coupled with STAR 580 STED dye (goat-anti-rabbit ...
-
bioRxiv - Microbiology 2021Quote: ... crescentus ParBΔCTD-CTPɣS complex crystal were also set up in sitting-drop vapour diffusion format in MRC2 96-well crystallization plates with drops comprised of 0.3 µL precipitant solution and 0.3 µL of protein solution (∼10 mg/mL) supplemented with 1 mM CTPɣS (Jena Biosciences) and 1 mM MgCl2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 μl of 40 μM PE* primer and 0.8 μl of 100 μM EvaGreen Fluorescent DNA Stain (Jena Bioscience). The reactions were amplified in a CFX96 Real-Time PCR instrument (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... Single-strand cDNA synthesis was carried out with 1 mg of total RNA using SCRIPT Reverse Transcriptase (Jena Bioscience). qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2023Quote: ... washed extensively with the loading buffer and eluted with the loading buffer supplemented with 1 mM m7GTP (Jena Bioscience). Input ...
-
bioRxiv - Cell Biology 2021Quote: ... 10% Biotinalyted and 65% unlabelled) was polymerised in the presence of 1 mM GMPCPP (NU-405 Jena BioScience, Jena, Germany) at 37 °C for 30 min ...
-
bioRxiv - Biochemistry 2021Quote: ... and DEPTOR (6.8 μM) were preincubated in the presence of 1 mM MgCl2 and 500 μM AMP-PNP (Jena Biosciences) for 20 min and used for cryo-EM grid preparation.
-
bioRxiv - Biochemistry 2021Quote: ... cells were labelled for 20 minutes with EU (5-ethynyl uridine, Jena Bioscience CLK-N002, final concentration at 1 mM). Harvested cells were firstly labeled with Zombie AquaTM (BioLegend ...
-
bioRxiv - Microbiology 2022Quote: ... were prepared for the MluCI and HpaII-digested DNA with mixes were prepared containing 1× ligation buffer (50 mM Tris-HCl pH 7.4 (Jena Bioscience), 10 mM MgCl2 (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2022Quote: ... 150 mM NaCl and time-lapse images were acquired while flowing in 0.3 μM dynamin mixed with 1 mM GTP (Jena Bioscience) and 1 mM MgCl2 in 20 mM HEPES pH 7.4 ...
-
bioRxiv - Biochemistry 2024Quote: ... Then, 0.9 ml of turbo DNase solution (15 mM MgSO4, 10 µg ml−1 turbo DNase (Jena Bioscience, EN-180), 1 mM TCEP and 0.5 mM phenylmethanesulfonyl fluoride ...
-
bioRxiv - Genomics 2024Quote: ... and fragment ends filled-in and biotinylated by adding 27.5 µl of a cocktail containing 15 µL 1 mM biotin-14-dUTP (Jena BioScience), dCTP ...
-
bioRxiv - Immunology 2021Quote: ... XCL1-K(N3) and sdAb-K(N3) were subsequently reacted with DBCO-Cy5.5 (3 equiv.) (CLK-1046, Jena BioSciences) overnight at RT on an end-over-end shaker ...
-
bioRxiv - Genetics 2021Quote: ... the PCR labelling Cy-3 and Cy-5 kits (Jena Bioscience, ref# PP-301L-Cy3 and #APP-101-Cy5) according to the manufacturer’s instructions with M13 universal primers ...
-
bioRxiv - Biophysics 2021Quote: ... MTs were prepared either with 0.75 µM mung tubulin or 30 µM goat brain tubulin in BRB-80 buffer with 1 mM GMPCPP (Jena Bioscience, Germany) and incubated at 37°C for 60 min ...
-
bioRxiv - Microbiology 2020Quote: ... The assay was carried out at 37°C and the reaction was started by addition of 1 mM pppGpp (Jena Bioscience), and samples for the nucleotide measurement were taken after 15 min ...
-
bioRxiv - Biochemistry 2020Quote: ... Additives as indicated were added during the primary antibody incubation step at a final concentration of 1 µM for adenosine (Jena Bioscience), AMP (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2020Quote: ... purified naïve C57BL/6 B2 cells were preincubated with a mixture of NIP-OVA and HIV-1 p17/p24/gp120 fusion protein (Jena Biosciences) covalently bound to 1 μm beads (1:1 bead:Bcell ratio ...
-
bioRxiv - Cell Biology 2020Quote: ... For synthesis of the 4sU-labeled spike-ins 1/10 of UTP in the transcription reactions was replaced with 4sUTP (Jena BioScience).
-
bioRxiv - Molecular Biology 2019Quote: ... GMPCPP-stabilized seeds were made by two rounds of polymerization in 25 µM tubulin (40% dig-tubulin) supplemented with 1 mM GMPCPP (Jena Biosciences) as described (Volkov et al. ...
-
bioRxiv - Physiology 2022Quote: ... glycoproteins were enriched using Concanavalin A and azido-modifed proteins were immobilized on magnetic DBCO-beads (Jena Bioscience #CLK-1037-1) via click chemistry ...
-
bioRxiv - Microbiology 2023Quote: ... 500 ng of RNA was reverse-transcribed with gene specific primers (Supplementary information 1) using the SCRIPT cDNA Synthesis Kit (Jena Bioscience) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: On-gel mito-FUNCAT was performed as described previously.72,114 HeLa S3 and MPV17L2 KO #1 cells were cultured in 6-well plates in methionine-free medium with 50 µM HPG (Jena Bioscience) and 100 µg/ml anisomycin (Alomone Labs ...
-
bioRxiv - Biochemistry 2023Quote: ... The chamber was pre-equilibrated with an oxygen scavenger cocktail 32 in 20 mM HEPES pH 7.4 with 150 mM NaCl and time-lapse images were acquired while flowing desired proteins in the same buffer in the absence or presence of 1 mM GTP (Jena Bioscience) and 1 mM MgCl2.
-
bioRxiv - Biochemistry 2020Quote: ... ∼900 μL of 4 μM forked DNA duplex and 100 μM ATPγS (Jena Bioscience, #NU-406-50) in Buffer S was applied to the column at 0.05 mL/min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 samples each) were extracted with CHAPS Lysis buffer from the Click Chemistry Capture Kit (Jena Bioscience). Input cell numbers were adjusted to give similar amount of total injected peptides ...
-
bioRxiv - Biochemistry 2021Quote: ... RNAs were fluorescently labeled with cyanine 5 at the 3’ end with the help of pCp-Cy5 (Jena Bioscience, 84179) and T4 RNA ligase I (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... in the presence of 0.4μL 5-(3-Aminoallyl)-uridine-5’-triphosphate labeled with ATTO 680(Aminoallyl-UTP-ATTO-680, NU-821-680, Jena bioscience) in each reaction ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then washed again 3x in 1xPBS and then incubated with 5 µM DBCO-488 (Jena Bioscience, CLK-1278-1) at 37 °C for 30 min or 5 µM Click-IT Alexa Fluor® 488 DIBO alkyne dye (ThermoScientific ...
-
bioRxiv - Biochemistry 2023Quote: ... the sequence of corresponding constructs of proLEG were cloned into pLEXSY-sat2.1 vectors and transfected into LEXSY P10 host strain of Leishmania tarentolae cells of the LEXSYcon2.1 expression system (Jena Biosciences, Jena, Germany). The resulting constructs carried N-terminal His6-tags and an N-terminal signal sequence for secretion into the supernatant ...
-
bioRxiv - Developmental Biology 2023Quote: ... After two additional washes the Tn5 was added (1:100) in CUT&Tag med buffer (20 mM HEPES [pH 7.5] (Jena Bioscience, #CSS-511), 300 mM NaCl (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 μg of protein was incubated overnight at 4°C with m7GTP agarose beads (Jena biosciences, #AC-155S). Beads were washed with cap binding buffer and suspended in 20 μL Laemmli buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were starved of methionine for one hour then 4-Azido-L-homoalanine HCl (L-AHA) (Jena Bioscience) was added to the media (final concentration 40μM ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 mM DMSO was used to dissolve 25 mM dibenzylcyclooctyne NHS (DBCO-NHS) ester purchased from Jena Bioscience. The DBCO-NHS ester was 33.3-fold molar excess over antibodies ...
-
bioRxiv - Immunology 2023Quote: ... they were injected intraperitoneally with 1.5mg L-AHA (Thermo) and then 4 hours later 1mg OPP (Jena Bioscience) dissolved in 100μl PBS ...
-
bioRxiv - Molecular Biology 2023Quote: T7 promoter containing double stranded DNA (Supplementary Table 3) was used as a template for in vitro transcription with HighYield T7 mRNA Synthesis Kit (ac4CTP) (Jena Bioscience).
-
bioRxiv - Cell Biology 2019Quote: ... fluorescently labelled and non-labelled tubulin in a ratio 18:12:70 (total of 20 μM tubulin) with 1 mM GMPCPP (NU-405 Jena BioScience, Jena, Germany) at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... and GTP or GDPCP were assembled in 1×10 buffer with 10 mM βME by preincubation of eEF1A and GTP (PromegaTM Corp., Madison, WI) or GDPCP (Jena Bioscience, Jena, Germany) for 5 minutes at 37°C followed by addition of tRNAAla or Ala-tRNAAla for 1 minute at 37°C and were then kept on ice until use ...
-
bioRxiv - Microbiology 2022Quote: ... The supernatant was collected and incubated with 2 ml of Ni-NTA Agarose (Jena Bioscience) pre-equilibrated with the lysis buffer for 2 hours at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: All nucleoside triphosphates (NTPs) and 2’-deoxy nucleoside triphosphates (dNTPs) were purchased from Jena Biosciences. Chemical and reagents used in synthesis were obtained from Merck ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... strains with MYO3 or MYO5 locus fused at its 3’ to the DHFR F[1,2] with a nourseothricin-resistance marker (NAT 100 μg/ml, Jena Bioscience GmbH, Germany). To insert the variant libraries instead of the wild-type SH3 domains ...
-
bioRxiv - Biophysics 2023Quote: ... we ran PCR reactions with added biotin-16-dUTP or 5-DBCO-(PEG)4-dUTP (Jena Biosciences GmbH, Jena, Germany), respectively ...
-
bioRxiv - Biochemistry 2023Quote: ... All exchange experiments reported in this article were initiated by incubation of G-actin (1 µM) with N6-(6-Amino)hexyl-ATP-ATTO-488 (0.1 µM; Jena Bioscience, Germany, ref. NU-805-488) in G+ME buffer (5mM Tris pH 7.5 ...
-
bioRxiv - Biochemistry 2023Quote: The kinetic measurements for the linked complexes were performed on Fluoromax-4 (Horiba) where the intensity of fluorescence emission by mant-labelled GDP/GMPPNP (Jena Bioscience, Germany) at 440 nm was monitored after the excitation at 360 nm (protocol similar to the one used in Baranwal ...
-
bioRxiv - Immunology 2024Quote: ... Immunostaining was performed in four steps to avoid unspecific binding of the secondary antibodies: i) incubation overnight at 4LJ with the mouse monoclonal IgG2a J2 antibody anti-dsRNA (Jena Bioscience, cat. RNT-SCI-10010500, dilution 1:200), ii ...
-
bioRxiv - Microbiology 2023Quote: The samples were vitrified in liquid ethane on glow-discharged 200 copper mesh R1.2/1.3 Quantifoil holey carbon coated grids with 2 nm continuous carbon on top (Jena Bioscience) using a Leica EM GP plunger at 85 % humidity with 1.5 s blotting time ...
-
bioRxiv - Microbiology 2023Quote: ... cultures (with an OD600 of approximately 0.3) were pulse-labeled with 250 µM 4-azido-L-homoalanine (AHA, Jena Bioscience, Cat. No. CLK-AA005) and incubated for 15 min at 37 °C ...
-
bioRxiv - Immunology 2021Quote: ... Azide-coupled Nbs were labeled by SPAAC (strain-promoted azide-alkyne cycloaddition) click chemistry reaction with 2-fold molar excess of DBCO-Cy5.5 (Jena Bioscience) for 2 h at 25°C ...
-
bioRxiv - Microbiology 2020Quote: ... Genome-labeled AdV was produced by growing the virus in A549 cells in the presence of 2.5 μM EdC (5-ethynyl-2’-deoxycytidine, Jena Biosciences) as described 52 ...
-
bioRxiv - Biochemistry 2023Quote: ... The sample was then incubated with a 2–fold excess of ε–ATP or ε–ADP (Jena Bioscience, Jena, Germany) for two hours on ice ...