Labshake search
Citations for Jena Bioscience :
151 - 200 of 231 citations for Somatostatin Receptor 1 SSTR1 Mouse Monoclonal biotin labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... anchored oligo-dT primer (1 µM, TTTTTTTTTTTTTTTTTTTTVN, Jena Bioscience), buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 mM Mg-GTP or Mg-GMPCPP (Jena Biosciences), and an oxygen scavenging system (80 μg/mL Catalase (Sigma C1345-1G) ...
-
bioRxiv - Biophysics 2022Quote: Cy3ATP was purchased from Jena Bioscience (1 mM stock). The 2’-deoxy-ATP labeled with N-Methylanthraniloyl at the 3’-ribose position (mantATP ...
-
bioRxiv - Biophysics 2022Quote: ... 1.5-1.8 µL 1 mM AF647-dUTP (Jena BioScience) and 0.75 µL 25 µM LacI-AF488 and incubated in the flow channel for between 10 and 15 min ...
-
bioRxiv - Plant Biology 2023Quote: ... or 100 μg mL−1 nourseothricin (Jena Bioscience, Germany).
-
bioRxiv - Developmental Biology 2021Quote: CRISPR-UMI cassettes were PCR amplified and multiplexed with 25 cycles of 1:1 KlenTag/Phusion PCR (Jena Bioscience and in house generated) using primers specified in (Michlits et al ...
-
bioRxiv - Cell Biology 2019Quote: ... Two crystallization screens were used JBScreen Basic 1 (Jena Bioscience) and JCSG plus (Molecular Dimensions) ...
-
bioRxiv - Biochemistry 2022Quote: ... 150 mM KCl buffer containing 1 mM GTP (Jena Bioscience) and 1 mM MgCl2 and the released inorganic phosphate was measured using a malachite green-based colorimetric assay (Baykov et al. ...
-
bioRxiv - Biophysics 2023Quote: Quantifoil R 2/1 300 mesh gold grids (Jena Bioscience) were washed sequentially with ddH2O and ethyl acetate ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 µM BODIPY-PEG4-DBCO (Jena Bioscience, Jena, Germany) and 100 nM MitoTracker Deep Red (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... or in 1 mM mant-ADP or mant-ATPγS (Jena Bioscience) in reservoir solution ...
-
bioRxiv - Biophysics 2020Quote: Cy3ATP and Cy3ADP were purchased from Jena Bioscience (1 mM stock). Alexa Fluor 488 C5 Maleimide powder was purchased from Invitrogen and dissolved in DMSO ...
-
bioRxiv - Bioengineering 2023Quote: ... K2 and k-1 values were determined measuring mGDP (Jena Bioscience) (excitation at 350 nm ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mM DTT) with 0.67 mM GMPCPP (Jena Bioscience, Jena, Germany) overnight at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... and 1 mM of the corresponding dideoxynucleotide triphosphate (Jena Bioscience, Jena, Germany). Reactions were performed according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... 50 µL of magnetic DBCO beads (Jena bioscience, Cat#CLK-1037-1) were washed twice with mass spec grade water and added to the eluate ...
-
bioRxiv - Cell Biology 2023Quote: ... in combination with AF-488-Picoyl-Azide (Jena Bioscience, CLK-1276-1). 10x Click iT reaction buffer was diluted 1 in 10 with monoQ H2O to make a 1 x solution freshly before use ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4EBP1 (20 µM) and 1 mM AMPPNP (Jena Bioscience NU-407-10) were mixed in ∼300 µL and incubated for 1 h on ice ...
-
bioRxiv - Genomics 2023Quote: ... Library PCRs were supplemented with 1× EvaGreen (Jena Bioscience cat. PCR-379). qPCRs were performed using index primers (NEBNext multiplex oligos for Illumina ...
-
bioRxiv - Cell Biology 2019Quote: ... The tubulin mix (20 μM) with 1 mM GMPCPP (NU-405L; Jena Bioscience) in BRB80 (80 mM Pipes pH 6.9 ...
-
bioRxiv - Microbiology 2022Quote: ... and 1× TranscriptAid enzyme mix and 6 mM cap analog m7GpppG (Jena Bioscience) or m7GpppA (prepared chemically according to a published protocol40) ...
-
bioRxiv - Biophysics 2023Quote: ... in the presence of 1 mM GMPCPP (NU-405L, Jena Bioscience, Jena, Germany) was prepared at 37 °C to nucleate short microtubule seeds ...
-
bioRxiv - Cell Biology 2019Quote: ... at a total tubulin concentration of 20 µM with 1 mM GMPCPP (Jena Biosciences) at 37° C for 30 minutes ...
-
bioRxiv - Biophysics 2019Quote: ... at a total final tubulin concentration of 20 µM with 1 mM GMPCPP (Jena Biosciences) at 37°C for 30 minutes ...
-
bioRxiv - Biophysics 2020Quote: ... Tubulin solutions were mixed with 1 µl 10 mM GMP-CPP (#NU-405S, Jena Bioscience) on ice and incubated for 10 minutes to allow nucleotide exchange ...
-
bioRxiv - Molecular Biology 2021Quote: ... Ribosome–EF-G complexes were applied to EM grids (Quantifoil 3.5/1 μm, Jena Bioscience) covered with pre-floated continuous carbon ...
-
bioRxiv - Biochemistry 2022Quote: ... The first crystals were found in several solutions of JB Screen Classic 1 (Jena Bioscience); for example ...
-
bioRxiv - Immunology 2023Quote: ... 1 µg/ml of recombinant YF17D-DIII or TBEV-DIII (Jena Bioscience, PR-1450-S) was used ...
-
bioRxiv - Cancer Biology 2023Quote: ... The concentrated RHEB was then incubated with 1 mM GMPPNP (Jena Bioscience NU-401-50) for 60 min at 4 °C and the protein was flash frozen in liquid nitrogen and stored at -80 °C.
-
bioRxiv - Biophysics 2024Quote: ... a 3:1 BrdU/BrdC mix (Sigma-Aldrich, #B5002, and Jena Bioscience, #N-DN-6496) was added to the cells ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells migrating in microfluidic devices were pulsed with 1 mM 5-ethynyl uridine (EU, Jena Bioscience) in complete DMEM for 4 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 mg of azide coupled bivalent Nb was incubated with 0.5 mL DBCO-Agarose (Jena Bioscience) slurry for 4 h at 25 °C ...
-
bioRxiv - Genomics 2021Quote: ... 1 μL of 0.05 mM 7-propargylamino-7-deaza-ddATP-6-FAM (Jena Bioscience, Jena, Germany), 0.4 μL of internal standard solution (see Supplementary Methods) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The sample-covered carbon was then adsorbed to an EM grid (Quantifoil R3.5/1, Jena Bioscience) and blotted for 9 s using a Vitrobot Mark IV (ThermoFisher ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified by PCR in the presence of 1:5 Digoxigenin-11-dUTP:dTTP (Jena Bioscience, Germany) using primers CD21 and CD26 (Supplementary Table 1) ...
-
bioRxiv - Plant Biology 2022Quote: ... Prepared samples were mixed with Regeneration agar containing nourseothricin (300 μg.ml-1, Jena BioScience, pNDN-OGG) or hygromycin (100 μg.ml-1 ...
-
bioRxiv - Biophysics 2023Quote: ... pH 7.4) with 1 mM guanosine-5’-[(α,β)-methyleno]triphosphate (GMPCPP; NU-405S, Jena Bioscience) and the solution was incubated for 30 min at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1% Igepal CA-630) after which a click reaction was performed with Sulfo-Cy5-Azide (Jena Bioscience) at the following concentrations ...
-
bioRxiv - Molecular Biology 2021Quote: ... Screening of crystallization conditions was carried out with JBScreen Classic 1 and 2 (Jena Bioscience, Jena, Germany). 2 µl of 9 mg/ml protein solution in 20 mM HEPES-NaOH pH 7.5 and 150 mM NaCl buffer were mixed with an equal volume of reservoir solution and equilibrated against 0.5 ml of reservoir solution ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 % CO2 for 1 h after a final concentration of 500 µM 5-Ethynyluridine (5EU, Jena Bioscience) was added ...
-
bioRxiv - Biophysics 2021Quote: The P3-[1-(2-nitrophenyl)ethyl] ester (NPE) of GTP was obtained from Jena Bioscience (Jena, Germany). P3-[para-hydroxyphenacyl] ester (pHP ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 µM P7/P8 and either 50 µM oxo- dGTP or 1 µM dPTP (Jena Bioscience, Germany). PCR products were DpnI digested for 1 h and 37°C and 5 ng of each product were used for a second PCR ...
-
bioRxiv - Biophysics 2021Quote: ... Double cycle GMPCPP polymerisation was performed as follows: reconstituted tubulin was supplemented with 1 mM GMPCPP (Jena Biosciences) and incubated for 5 mins on ice ...
-
bioRxiv - Immunology 2020Quote: ... Vero E6 cells were incubated with a 1:500 dilution of an anti-dsRNA J2 antibody (Jena Bioscience) in PBS supplemented with 1% FCS at 4°C overnight with shaking ...
-
bioRxiv - Plant Biology 2023Quote: ... then 5×106 cells were plated on ESAW agar plates containing 450 μg mL-1 nourseothricin (Jena Bioscience), and incubated in constant light at 18 °C.
-
bioRxiv - Biochemistry 2023Quote: ... and GDPCP was assembled in 1×10 buffer by preincubation of eEF1A and GDPCP (Jena Bioscience, Jena, Germany) for 5 minutes at 30°C followed by addition of Ala-tRNAAla for 1 minute at 30°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Endogenous and overexpressed PML was immunofluorescently labelled with anti-PML antibody (rabbit, ABD-030, Jena Bioscience, Germany, 1:500), followed by secondary antibody coupled with STAR 580 STED dye (goat-anti-rabbit ...
-
bioRxiv - Microbiology 2021Quote: ... crescentus ParBΔCTD-CTPɣS complex crystal were also set up in sitting-drop vapour diffusion format in MRC2 96-well crystallization plates with drops comprised of 0.3 µL precipitant solution and 0.3 µL of protein solution (∼10 mg/mL) supplemented with 1 mM CTPɣS (Jena Biosciences) and 1 mM MgCl2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 μl of 40 μM PE* primer and 0.8 μl of 100 μM EvaGreen Fluorescent DNA Stain (Jena Bioscience). The reactions were amplified in a CFX96 Real-Time PCR instrument (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... Single-strand cDNA synthesis was carried out with 1 mg of total RNA using SCRIPT Reverse Transcriptase (Jena Bioscience). qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).