Labshake search
Citations for Jena Bioscience :
151 - 200 of 214 citations for Rat Oxidation resistance protein 1 Oxr1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... Purified PCR products and plasmid DNAs were labeled with ATTO488-dUTP or ATTO550-dUTP using Fluorescent Nick Translation Labeling kits (Jena Bioscience, Germany).
-
bioRxiv - Evolutionary Biology 2023Quote: ... and the PCR products were labeled with Atto550-dUTP (red) or Atto488-dUTP (green) according to the manufacturer’s recommendations using the Nick-Translation mix kit (Jena Bioscience, Jena, Germany). The probes were then hybridized in all other Alligatoridae species according to the methodology reported by Yano et al ...
-
bioRxiv - Physiology 2024Quote: ... All cell stocks were regularly checked for absence of mycoplasma with the Mycoplasma Detection Kit (Jena Bioscience, Jena, Thüringen, Germany, #PP-401).
-
bioRxiv - Biophysics 2019Quote: ... at a total final tubulin concentration of 20 µM with 1 mM GMPCPP (Jena Biosciences) at 37°C for 30 minutes ...
-
bioRxiv - Biophysics 2020Quote: ... Tubulin solutions were mixed with 1 µl 10 mM GMP-CPP (#NU-405S, Jena Bioscience) on ice and incubated for 10 minutes to allow nucleotide exchange ...
-
bioRxiv - Molecular Biology 2021Quote: ... Ribosome–EF-G complexes were applied to EM grids (Quantifoil 3.5/1 μm, Jena Bioscience) covered with pre-floated continuous carbon ...
-
bioRxiv - Biochemistry 2022Quote: ... The first crystals were found in several solutions of JB Screen Classic 1 (Jena Bioscience); for example ...
-
bioRxiv - Immunology 2023Quote: ... 1 µg/ml of recombinant YF17D-DIII or TBEV-DIII (Jena Bioscience, PR-1450-S) was used ...
-
bioRxiv - Cancer Biology 2023Quote: ... The concentrated RHEB was then incubated with 1 mM GMPPNP (Jena Bioscience NU-401-50) for 60 min at 4 °C and the protein was flash frozen in liquid nitrogen and stored at -80 °C.
-
bioRxiv - Biophysics 2024Quote: ... a 3:1 BrdU/BrdC mix (Sigma-Aldrich, #B5002, and Jena Bioscience, #N-DN-6496) was added to the cells ...
-
bioRxiv - Plant Biology 2020Quote: ... The lysate was cleared by centrifugation and RNA was extracted using RNA purification kit as described by the manufacture (Jena Bioscience, PP-210), followed by DNase I treatment ...
-
bioRxiv - Biochemistry 2022Quote: Initial crystallization conditions for P9-1ΔC-arm were screened at room temperature on 96-well sitting-drop Greiner 609120 plates using a Digilab Honeybee963 robot (Marlborough, USA) and commercial kits from Jena Bioscience (Jena, Germany) and Hampton Research (Aliso Viejo ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells migrating in microfluidic devices were pulsed with 1 mM 5-ethynyl uridine (EU, Jena Bioscience) in complete DMEM for 4 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 mg of azide coupled bivalent Nb was incubated with 0.5 mL DBCO-Agarose (Jena Bioscience) slurry for 4 h at 25 °C ...
-
bioRxiv - Genomics 2021Quote: ... 1 μL of 0.05 mM 7-propargylamino-7-deaza-ddATP-6-FAM (Jena Bioscience, Jena, Germany), 0.4 μL of internal standard solution (see Supplementary Methods) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The sample-covered carbon was then adsorbed to an EM grid (Quantifoil R3.5/1, Jena Bioscience) and blotted for 9 s using a Vitrobot Mark IV (ThermoFisher ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified by PCR in the presence of 1:5 Digoxigenin-11-dUTP:dTTP (Jena Bioscience, Germany) using primers CD21 and CD26 (Supplementary Table 1) ...
-
bioRxiv - Plant Biology 2022Quote: ... Prepared samples were mixed with Regeneration agar containing nourseothricin (300 μg.ml-1, Jena BioScience, pNDN-OGG) or hygromycin (100 μg.ml-1 ...
-
bioRxiv - Biophysics 2023Quote: ... pH 7.4) with 1 mM guanosine-5’-[(α,β)-methyleno]triphosphate (GMPCPP; NU-405S, Jena Bioscience) and the solution was incubated for 30 min at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1% Igepal CA-630) after which a click reaction was performed with Sulfo-Cy5-Azide (Jena Bioscience) at the following concentrations ...
-
bioRxiv - Molecular Biology 2021Quote: ... Screening of crystallization conditions was carried out with JBScreen Classic 1 and 2 (Jena Bioscience, Jena, Germany). 2 µl of 9 mg/ml protein solution in 20 mM HEPES-NaOH pH 7.5 and 150 mM NaCl buffer were mixed with an equal volume of reservoir solution and equilibrated against 0.5 ml of reservoir solution ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 % CO2 for 1 h after a final concentration of 500 µM 5-Ethynyluridine (5EU, Jena Bioscience) was added ...
-
bioRxiv - Biophysics 2021Quote: The P3-[1-(2-nitrophenyl)ethyl] ester (NPE) of GTP was obtained from Jena Bioscience (Jena, Germany). P3-[para-hydroxyphenacyl] ester (pHP ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 µM P7/P8 and either 50 µM oxo- dGTP or 1 µM dPTP (Jena Bioscience, Germany). PCR products were DpnI digested for 1 h and 37°C and 5 ng of each product were used for a second PCR ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we added all four nucleotides at a final concentration of 1 µM (Biotin-7-dATP, Jena Biosciences, and dC-Atto647N or dU-Atto488 ...
-
bioRxiv - Biophysics 2021Quote: ... Double cycle GMPCPP polymerisation was performed as follows: reconstituted tubulin was supplemented with 1 mM GMPCPP (Jena Biosciences) and incubated for 5 mins on ice ...
-
bioRxiv - Immunology 2020Quote: ... Vero E6 cells were incubated with a 1:500 dilution of an anti-dsRNA J2 antibody (Jena Bioscience) in PBS supplemented with 1% FCS at 4°C overnight with shaking ...
-
bioRxiv - Plant Biology 2023Quote: ... then 5×106 cells were plated on ESAW agar plates containing 450 μg mL-1 nourseothricin (Jena Bioscience), and incubated in constant light at 18 °C.
-
bioRxiv - Biochemistry 2023Quote: ... and GDPCP was assembled in 1×10 buffer by preincubation of eEF1A and GDPCP (Jena Bioscience, Jena, Germany) for 5 minutes at 30°C followed by addition of Ala-tRNAAla for 1 minute at 30°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Endogenous and overexpressed PML was immunofluorescently labelled with anti-PML antibody (rabbit, ABD-030, Jena Bioscience, Germany, 1:500), followed by secondary antibody coupled with STAR 580 STED dye (goat-anti-rabbit ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 μl of 40 μM PE* primer and 0.8 μl of 100 μM EvaGreen Fluorescent DNA Stain (Jena Bioscience). The reactions were amplified in a CFX96 Real-Time PCR instrument (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... Single-strand cDNA synthesis was carried out with 1 mg of total RNA using SCRIPT Reverse Transcriptase (Jena Bioscience). qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2023Quote: ... washed extensively with the loading buffer and eluted with the loading buffer supplemented with 1 mM m7GTP (Jena Bioscience). Input ...
-
bioRxiv - Biophysics 2022Quote: ... 1 µg of the restriction product was used as template for in vitro transcription using HighYield T7 Atto488 RNA labeling kit (Jena Bioscience, Jena, Germany, RNT-101-488-S), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 10% Biotinalyted and 65% unlabelled) was polymerised in the presence of 1 mM GMPCPP (NU-405 Jena BioScience, Jena, Germany) at 37 °C for 30 min ...
-
bioRxiv - Biophysics 2020Quote: ... of λ-DNA using the following primers: 5’-CGAACTCTTCAAATTCTTCTTCCA-3’ and 5’-GATTGCTCTTCTGTAAGGTTTTG-3’ with a 5:1 ratio of dTTP:biotin-11-dUTP (Jena Bioscience). Similarly ...
-
bioRxiv - Biophysics 2020Quote: ... 5’-TAGTCCAGAACGAGACCGCAACAGCACAACCCAAACTG-3’ and 5’-AATCTGCTGCAATGCCACAG-3’ (underline section indicates overhang) with a 10:1 ratio of dTTP:digoxigenin-11-dUTP (Jena Bioscience). The labelled fragments were purified using a PCR purification kit (QIAquick ...
-
bioRxiv - Biochemistry 2021Quote: ... and DEPTOR (6.8 μM) were preincubated in the presence of 1 mM MgCl2 and 500 μM AMP-PNP (Jena Biosciences) for 20 min and used for cryo-EM grid preparation.
-
bioRxiv - Biochemistry 2021Quote: ... cells were labelled for 20 minutes with EU (5-ethynyl uridine, Jena Bioscience CLK-N002, final concentration at 1 mM). Harvested cells were firstly labeled with Zombie AquaTM (BioLegend ...
-
bioRxiv - Microbiology 2022Quote: ... were prepared for the MluCI and HpaII-digested DNA with mixes were prepared containing 1× ligation buffer (50 mM Tris-HCl pH 7.4 (Jena Bioscience), 10 mM MgCl2 (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2022Quote: ... 150 mM NaCl and time-lapse images were acquired while flowing in 0.3 μM dynamin mixed with 1 mM GTP (Jena Bioscience) and 1 mM MgCl2 in 20 mM HEPES pH 7.4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 68% unlabelled tubulin) for 1 h at 37 ֯C in BRB80 supplemented with 2.7 mM GMPCPP (Jena Bioscience, NU-405). The polymerized microtubules were centrifuged for 30 min at 18000 x g in a Microfuge 18 Centrifuge (Beckman Coulter) ...
-
bioRxiv - Biochemistry 2024Quote: ... Then, 0.9 ml of turbo DNase solution (15 mM MgSO4, 10 µg ml−1 turbo DNase (Jena Bioscience, EN-180), 1 mM TCEP and 0.5 mM phenylmethanesulfonyl fluoride ...
-
bioRxiv - Genomics 2024Quote: ... and fragment ends filled-in and biotinylated by adding 27.5 µl of a cocktail containing 15 µL 1 mM biotin-14-dUTP (Jena BioScience), dCTP ...
-
bioRxiv - Biophysics 2021Quote: ... MTs were prepared either with 0.75 µM mung tubulin or 30 µM goat brain tubulin in BRB-80 buffer with 1 mM GMPCPP (Jena Bioscience, Germany) and incubated at 37°C for 60 min ...
-
bioRxiv - Microbiology 2020Quote: ... The assay was carried out at 37°C and the reaction was started by addition of 1 mM pppGpp (Jena Bioscience), and samples for the nucleotide measurement were taken after 15 min ...
-
bioRxiv - Biochemistry 2020Quote: ... Additives as indicated were added during the primary antibody incubation step at a final concentration of 1 µM for adenosine (Jena Bioscience), AMP (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... For synthesis of the 4sU-labeled spike-ins 1/10 of UTP in the transcription reactions was replaced with 4sUTP (Jena BioScience).
-
bioRxiv - Molecular Biology 2019Quote: ... GMPCPP-stabilized seeds were made by two rounds of polymerization in 25 µM tubulin (40% dig-tubulin) supplemented with 1 mM GMPCPP (Jena Biosciences) as described (Volkov et al. ...
-
bioRxiv - Cell Biology 2023Quote: On-gel mito-FUNCAT was performed as described previously.72,114 HeLa S3 and MPV17L2 KO #1 cells were cultured in 6-well plates in methionine-free medium with 50 µM HPG (Jena Bioscience) and 100 µg/ml anisomycin (Alomone Labs ...