Labshake search
Citations for Jena Bioscience :
151 - 193 of 193 citations for Endothelin 1 ET 1 ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... for GTP analog treated samples Non-hydrolyzable GTP Test Kit (Jena Bioscience #NK-102) containing 5 analogs – GTPαS ...
-
bioRxiv - Molecular Biology 2022Quote: ... we performed click chemistry using the CuAAC Biomolecule Reaction Buffer Kit-BTTAA based (Jena Biosciences). Following click chemistry ...
-
bioRxiv - Plant Biology 2024Quote: ... The Cy5 probe was generated using the HighYield T7 Cy5 RNA Labelling Kit (Jena Bioscience) with a T7-gfp PCR product as template ...
-
bioRxiv - Plant Biology 2019Quote: Fluorescent labeling of dsRNA was performed using the Atto 488 RNA Labeling Kit (Jena Bioscience, Jena, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... dUTP-ATTO-550 or dUTP-ATTO-488 using a nick translation labelling kit (Jena Bioscience, http://www.jenabioscience.com).
-
bioRxiv - Molecular Biology 2021Quote: ... 4 samples each) were extracted with CHAPS Lysis buffer from the Click Chemistry Capture Kit (Jena Bioscience). Input cell numbers were adjusted to give similar amount of total injected peptides ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA from each clone was labeled through nick translation with either the Atto550 NT Labeling Kit (Jena Bioscience) or the Digoxigenin NT Labeling Kit (Jena Bioscience) ...
-
bioRxiv - Plant Biology 2021Quote: Fluorescence labeling of SaMIF1-dsRNA was performed using the HighYield T7 AF488 RNA Labeling Kit (Jena Bioscience, Germany) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: C15-az and C17-az modified proteins were pulled down using the Click Chemistry Capture Kit (Jena Bioscience) and alkyne agarose beads (Jena Bioscience) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... probes were labelled by nick translation with Cy3-dUTP using Cy3 NT Labeling Kit (Jena Bioscience, Jena, Germany). In this case ...
-
bioRxiv - Genomics 2019Quote: ... 1ug phosphorylated oligo was incubated with reagents from the CuAAC Biomolecule Reaction Buffer kit (Jena Bioscience CLK-072) and 250uM azide for 1h at 37C ...
-
bioRxiv - Molecular Biology 2021Quote: ... in vitro transcription was performed using the HighYield T7 Cy3 RNA Labelling Kit (Jena Bioscience, RNT-101-CY3) in accordance to the instructions of the manufacturer ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: Random mutagenesis was carried out in a 50 µl reaction with the JBS dNTP-Mutagenesis Kit (Jena Bioscience) with 5 µM dNTP analogs ...
-
bioRxiv - Systems Biology 2023Quote: ... followed by column purification (Zebaspin RNA clean&concentrator kit) and subsequent coupling to DBCO-PEG12-TCO (Jena Biosciences) at 1:5 molar ratio overnight at room temperature ...
-
bioRxiv - Genetics 2023Quote: ... The entire plasmids were labeled by nick translation using a Cy3 NT Labeling Kit (Jena Bioscience, Jena, Germany). For the final probe mixture preparation ...
-
bioRxiv - Genetics 2021Quote: ... the PCR labelling Cy-3 and Cy-5 kits (Jena Bioscience, ref# PP-301L-Cy3 and #APP-101-Cy5) according to the manufacturer’s instructions with M13 universal primers ...
-
bioRxiv - Biochemistry 2020Quote: ... affinity chromatography of CDPK1 pre-incubated with the compounds was performed by utilizing ATP Affinity Test Kit (Jena Bioscience). Protocol was followed as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2019Quote: All PCR products with the expected size were purified using the SAP-Exo Kit (Jena Bioscience GmbH, Jena, Germany) and Sanger sequenced from both directions by LGC Genomics (Berlin ...
-
bioRxiv - Systems Biology 2022Quote: ... All cell stocks were regularly checked for absence of mycoplasma with the Mycoplasma Detection Kit (Jena Bioscience; # PP-401).
-
bioRxiv - Genomics 2023Quote: ... Mycoplasma was tested to be negative for all cellular input reported using Mycoplasma Detection Kit (Jena Bioscience PP-401) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: Cell lines are regularly checked for the absence of Mycoplasma using a PCR based detection kit (Jena Biosciences PP-401).
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were tested at least once in two months for Mycoplasma contamination using Mycoplasma Detection Kit (Jena Bioscience PP-401L).
-
bioRxiv - Biochemistry 2023Quote: ... mESCs were checked once during cultivation for Mycoplasma contamination using a PCR-based mycoplasma detection kit (Jena Bioscience #PP-401L) as indicated by the manufacturer.
-
bioRxiv - Molecular Biology 2024Quote: ... In vitro transcription was performed using a T7-Scribe Standard RNA IVT Kit (CELLSCRIPT) in the presence of 1.2 mM BrUTP (Jena Bioscience) and 5 mM UTP ...
-
bioRxiv - Molecular Biology 2024Quote: ... In vitro transcription was performed using a T7-Scribe Standard RNA IVT Kit (CELLSCRIPT) in the presence of 1.2 mM BrUTP (Jena Bioscience) and 5 mM UTP ...
-
bioRxiv - Molecular Biology 2021Quote: T7 promoter containing double stranded DNA was used as a template for in vitro transcription with HighYield T7 mRNA Synthesis Kit (ac4CTP) (Jena Bioscience) (sense strand 5’ GTACGGTAATACGACTCACTATAGGGAGTGGTCTACACACATGACAGAATGGGGCAGGTCCGTAATCGGTTGCAGAGCGGTTACCGATCTCATCGC 3’ and antisense strand 5’ GGCCGCGATGAGATCGGTAACCGCTCTGCAACCGATTACGGACCTGCCCCATTCTGTCATGTGTGTAGACCACTCCCTATAGTGAGTCGTATTACC 3’) ...
-
bioRxiv - Microbiology 2019Quote: ... mt COI and ap ORF470 of the expected size were purified using the SAP-Exo Kit (Jena Bioscience GmbH, Jena, Germany), and sequenced in both directions by LGC Genomics (Berlin ...
-
bioRxiv - Cell Biology 2019Quote: HA-photocholesterol complexes were then clicked to Pico-azido picolyl sulfo cy3 by using the CuAAC Biomolecule Reaction Buffer Kit (Jena Bioscience). Samples were subjected to SDS-PAGE and HA-photocholesterol was visualized using the Typhoon FLA 9500 scanner (Excitation =555 nm ...
-
bioRxiv - Microbiology 2020Quote: ... denatured for 3 min at 90°C and subjected to separation using a denaturing 8% sequencing gel in presence of a RyeG-specific sequencing ladder prepared using the DNA Cycle Sequencing kit (Jena Bioscience) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Simultaneous in situ hybridization included Nick-translation labelled genomic DNA from barley (AF594 NT Labeling Kit, PP-305L-AF594, Jena Bioscience) and the TRS-probe (AF488 NT Labeling Kit ...
-
bioRxiv - Plant Biology 2022Quote: ... and protease inhibitor cocktail) and incubated with nucleotide-linked agarose beads (AMP and ATP affinity test kits, Jena Biosciences, Jena, Germany) overnight on the wheel at 4°C at a final concentration of 0.2% ß-DM ...
-
bioRxiv - Genetics 2023Quote: ... The entire plasmid was used as a template for nick translation using a Cy3 NT Labeling Kit (Jena Bioscience, Jena, Germany). For the final probe mixture preparation ...
-
bioRxiv - Molecular Biology 2023Quote: T7 promoter containing double stranded DNA (Supplementary Table 3) was used as a template for in vitro transcription with HighYield T7 mRNA Synthesis Kit (ac4CTP) (Jena Bioscience).
-
bioRxiv - Physiology 2023Quote: ... and cDNA was synthesised from 2 µg of RNA by reverse transcription (SCRIPT cDNA Synthesis Kit, Jena Bioscience GmBH, Jena, Germany). Gene expression assays for Il1b (Rn00580432_m1) ...
-
bioRxiv - Microbiology 2024Quote: ... of 5’-triphosphate (PPP) Qβ-RNA and RNAI was performed in a 20 µL scale using the HighYield T7 RNA Synthesis Kit (Jena Bioscience) according to manufacturer’s instructions in the presence of 1 µg dsDNA template ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 100% m6A modified full-length PAN transcript was synthesized using the MEGAscript T7 Transcription Kit following the manufacturer’s protocol but substituting adenosine-triphosphate with N6-methyladenosine-5’-triphosphate (Jena Bioscience NU-1101S). RNAs were purified using the MEGAclear Transcription Clean-Up Kit (ThermoFisher AM1908).
-
bioRxiv - Microbiology 2020Quote: ... and expression of the host Leishmania tarentolae strain T7-TR were performed according to the Jena Bioscience protocol for inducible expression of recombinant proteins secreted to medium (LEXSinduce Expression kit, Jena Bioscience, Germany). Expression of proKLK13 and proKLK14 was induced with 15 µg/ml of tetracycline (BioShop ...
-
bioRxiv - Plant Biology 2022Quote: ... Purified PCR products and plasmid DNAs were labeled with ATTO488-dUTP or ATTO550-dUTP using Fluorescent Nick Translation Labeling kits (Jena Bioscience, Germany).
-
bioRxiv - Evolutionary Biology 2023Quote: ... and the PCR products were labeled with Atto550-dUTP (red) or Atto488-dUTP (green) according to the manufacturer’s recommendations using the Nick-Translation mix kit (Jena Bioscience, Jena, Germany). The probes were then hybridized in all other Alligatoridae species according to the methodology reported by Yano et al ...
-
bioRxiv - Physiology 2024Quote: ... All cell stocks were regularly checked for absence of mycoplasma with the Mycoplasma Detection Kit (Jena Bioscience, Jena, Thüringen, Germany, #PP-401).
-
bioRxiv - Plant Biology 2020Quote: ... The lysate was cleared by centrifugation and RNA was extracted using RNA purification kit as described by the manufacture (Jena Bioscience, PP-210), followed by DNase I treatment ...
-
bioRxiv - Immunology 2019Quote: ... suis proteins were amplified and cloned into the vector pLEXSYsat2 of the Leishmania Expression System (LEXSYcon2 Expression Kit, Jena Bioscience GmbH, Jena, Germany). The cloning vector was sequenced for verification ...
-
bioRxiv - Biophysics 2022Quote: ... 1 µg of the restriction product was used as template for in vitro transcription using HighYield T7 Atto488 RNA labeling kit (Jena Bioscience, Jena, Germany, RNT-101-488-S), according to the manufacturer’s instructions ...