Labshake search
Citations for Jena Bioscience :
101 - 150 of 192 citations for Cortisol ELISA Kit 1 Strip plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: All PCR products with the expected size were purified using the SAP-Exo Kit (Jena Bioscience GmbH, Jena, Germany) and Sanger sequenced from both directions by LGC Genomics (Berlin ...
-
bioRxiv - Systems Biology 2022Quote: ... All cell stocks were regularly checked for absence of mycoplasma with the Mycoplasma Detection Kit (Jena Bioscience; # PP-401).
-
bioRxiv - Genomics 2023Quote: ... Mycoplasma was tested to be negative for all cellular input reported using Mycoplasma Detection Kit (Jena Bioscience PP-401) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... The tubulin mix (20 μM) with 1 mM GMPCPP (NU-405L; Jena Bioscience) in BRB80 (80 mM Pipes pH 6.9 ...
-
bioRxiv - Microbiology 2022Quote: ... and 1× TranscriptAid enzyme mix and 6 mM cap analog m7GpppG (Jena Bioscience) or m7GpppA (prepared chemically according to a published protocol40) ...
-
bioRxiv - Biophysics 2023Quote: ... in the presence of 1 mM GMPCPP (NU-405L, Jena Bioscience, Jena, Germany) was prepared at 37 °C to nucleate short microtubule seeds ...
-
bioRxiv - Biophysics 2024Quote: ... 1 MgCl2 and labeled in 300 nM of pyrimidyl-tetrazine-Alexa647 (JENA Biosciences) for 15-20 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: Cell lines are regularly checked for the absence of Mycoplasma using a PCR based detection kit (Jena Biosciences PP-401).
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were tested at least once in two months for Mycoplasma contamination using Mycoplasma Detection Kit (Jena Bioscience PP-401L).
-
bioRxiv - Biochemistry 2023Quote: ... mESCs were checked once during cultivation for Mycoplasma contamination using a PCR-based mycoplasma detection kit (Jena Bioscience #PP-401L) as indicated by the manufacturer.
-
bioRxiv - Molecular Biology 2024Quote: ... In vitro transcription was performed using a T7-Scribe Standard RNA IVT Kit (CELLSCRIPT) in the presence of 1.2 mM BrUTP (Jena Bioscience) and 5 mM UTP ...
-
bioRxiv - Molecular Biology 2024Quote: ... In vitro transcription was performed using a T7-Scribe Standard RNA IVT Kit (CELLSCRIPT) in the presence of 1.2 mM BrUTP (Jena Bioscience) and 5 mM UTP ...
-
bioRxiv - Cell Biology 2019Quote: ... at a total tubulin concentration of 20 µM with 1 mM GMPCPP (Jena Biosciences) at 37° C for 30 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... nascent peptides within mitochondria were labeled with 1 μM azide-conjugated Cy3 (Jena Bioscience) with a Click-it Cell Reaction Buffer Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: T7 promoter containing double stranded DNA was used as a template for in vitro transcription with HighYield T7 mRNA Synthesis Kit (ac4CTP) (Jena Bioscience) (sense strand 5’ GTACGGTAATACGACTCACTATAGGGAGTGGTCTACACACATGACAGAATGGGGCAGGTCCGTAATCGGTTGCAGAGCGGTTACCGATCTCATCGC 3’ and antisense strand 5’ GGCCGCGATGAGATCGGTAACCGCTCTGCAACCGATTACGGACCTGCCCCATTCTGTCATGTGTGTAGACCACTCCCTATAGTGAGTCGTATTACC 3’) ...
-
bioRxiv - Microbiology 2019Quote: ... mt COI and ap ORF470 of the expected size were purified using the SAP-Exo Kit (Jena Bioscience GmbH, Jena, Germany), and sequenced in both directions by LGC Genomics (Berlin ...
-
bioRxiv - Cell Biology 2019Quote: HA-photocholesterol complexes were then clicked to Pico-azido picolyl sulfo cy3 by using the CuAAC Biomolecule Reaction Buffer Kit (Jena Bioscience). Samples were subjected to SDS-PAGE and HA-photocholesterol was visualized using the Typhoon FLA 9500 scanner (Excitation =555 nm ...
-
bioRxiv - Microbiology 2020Quote: ... denatured for 3 min at 90°C and subjected to separation using a denaturing 8% sequencing gel in presence of a RyeG-specific sequencing ladder prepared using the DNA Cycle Sequencing kit (Jena Bioscience) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Simultaneous in situ hybridization included Nick-translation labelled genomic DNA from barley (AF594 NT Labeling Kit, PP-305L-AF594, Jena Bioscience) and the TRS-probe (AF488 NT Labeling Kit ...
-
bioRxiv - Plant Biology 2022Quote: ... and protease inhibitor cocktail) and incubated with nucleotide-linked agarose beads (AMP and ATP affinity test kits, Jena Biosciences, Jena, Germany) overnight on the wheel at 4°C at a final concentration of 0.2% ß-DM ...
-
bioRxiv - Genetics 2023Quote: ... The entire plasmid was used as a template for nick translation using a Cy3 NT Labeling Kit (Jena Bioscience, Jena, Germany). For the final probe mixture preparation ...
-
bioRxiv - Molecular Biology 2023Quote: T7 promoter containing double stranded DNA (Supplementary Table 3) was used as a template for in vitro transcription with HighYield T7 mRNA Synthesis Kit (ac4CTP) (Jena Bioscience).
-
bioRxiv - Physiology 2023Quote: ... and cDNA was synthesised from 2 µg of RNA by reverse transcription (SCRIPT cDNA Synthesis Kit, Jena Bioscience GmBH, Jena, Germany). Gene expression assays for Il1b (Rn00580432_m1) ...
-
bioRxiv - Microbiology 2024Quote: ... of 5’-triphosphate (PPP) Qβ-RNA and RNAI was performed in a 20 µL scale using the HighYield T7 RNA Synthesis Kit (Jena Bioscience) according to manufacturer’s instructions in the presence of 1 µg dsDNA template ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 100% m6A modified full-length PAN transcript was synthesized using the MEGAscript T7 Transcription Kit following the manufacturer’s protocol but substituting adenosine-triphosphate with N6-methyladenosine-5’-triphosphate (Jena Bioscience NU-1101S). RNAs were purified using the MEGAclear Transcription Clean-Up Kit (ThermoFisher AM1908).
-
bioRxiv - Microbiology 2020Quote: ... and expression of the host Leishmania tarentolae strain T7-TR were performed according to the Jena Bioscience protocol for inducible expression of recombinant proteins secreted to medium (LEXSinduce Expression kit, Jena Bioscience, Germany). Expression of proKLK13 and proKLK14 was induced with 15 µg/ml of tetracycline (BioShop ...
-
bioRxiv - Plant Biology 2022Quote: ... Purified PCR products and plasmid DNAs were labeled with ATTO488-dUTP or ATTO550-dUTP using Fluorescent Nick Translation Labeling kits (Jena Bioscience, Germany).
-
bioRxiv - Evolutionary Biology 2023Quote: ... and the PCR products were labeled with Atto550-dUTP (red) or Atto488-dUTP (green) according to the manufacturer’s recommendations using the Nick-Translation mix kit (Jena Bioscience, Jena, Germany). The probes were then hybridized in all other Alligatoridae species according to the methodology reported by Yano et al ...
-
bioRxiv - Physiology 2024Quote: ... All cell stocks were regularly checked for absence of mycoplasma with the Mycoplasma Detection Kit (Jena Bioscience, Jena, Thüringen, Germany, #PP-401).
-
bioRxiv - Biophysics 2019Quote: ... at a total final tubulin concentration of 20 µM with 1 mM GMPCPP (Jena Biosciences) at 37°C for 30 minutes ...
-
bioRxiv - Biophysics 2020Quote: ... Tubulin solutions were mixed with 1 µl 10 mM GMP-CPP (#NU-405S, Jena Bioscience) on ice and incubated for 10 minutes to allow nucleotide exchange ...
-
bioRxiv - Molecular Biology 2021Quote: ... Ribosome–EF-G complexes were applied to EM grids (Quantifoil 3.5/1 μm, Jena Bioscience) covered with pre-floated continuous carbon ...
-
bioRxiv - Biochemistry 2022Quote: ... The first crystals were found in several solutions of JB Screen Classic 1 (Jena Bioscience); for example ...
-
bioRxiv - Immunology 2023Quote: ... 1 µg/ml of recombinant YF17D-DIII or TBEV-DIII (Jena Bioscience, PR-1450-S) was used ...
-
bioRxiv - Cancer Biology 2023Quote: ... The concentrated RHEB was then incubated with 1 mM GMPPNP (Jena Bioscience NU-401-50) for 60 min at 4 °C and the protein was flash frozen in liquid nitrogen and stored at -80 °C.
-
bioRxiv - Biophysics 2024Quote: ... a 3:1 BrdU/BrdC mix (Sigma-Aldrich, #B5002, and Jena Bioscience, #N-DN-6496) was added to the cells ...
-
bioRxiv - Plant Biology 2020Quote: ... The lysate was cleared by centrifugation and RNA was extracted using RNA purification kit as described by the manufacture (Jena Bioscience, PP-210), followed by DNase I treatment ...
-
bioRxiv - Immunology 2019Quote: ... suis proteins were amplified and cloned into the vector pLEXSYsat2 of the Leishmania Expression System (LEXSYcon2 Expression Kit, Jena Bioscience GmbH, Jena, Germany). The cloning vector was sequenced for verification ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells migrating in microfluidic devices were pulsed with 1 mM 5-ethynyl uridine (EU, Jena Bioscience) in complete DMEM for 4 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 mg of azide coupled bivalent Nb was incubated with 0.5 mL DBCO-Agarose (Jena Bioscience) slurry for 4 h at 25 °C ...
-
bioRxiv - Genomics 2021Quote: ... 1 μL of 0.05 mM 7-propargylamino-7-deaza-ddATP-6-FAM (Jena Bioscience, Jena, Germany), 0.4 μL of internal standard solution (see Supplementary Methods) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The sample-covered carbon was then adsorbed to an EM grid (Quantifoil R3.5/1, Jena Bioscience) and blotted for 9 s using a Vitrobot Mark IV (ThermoFisher ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified by PCR in the presence of 1:5 Digoxigenin-11-dUTP:dTTP (Jena Bioscience, Germany) using primers CD21 and CD26 (Supplementary Table 1) ...
-
bioRxiv - Plant Biology 2022Quote: ... Prepared samples were mixed with Regeneration agar containing nourseothricin (300 μg.ml-1, Jena BioScience, pNDN-OGG) or hygromycin (100 μg.ml-1 ...
-
bioRxiv - Biophysics 2023Quote: ... pH 7.4) with 1 mM guanosine-5’-[(α,β)-methyleno]triphosphate (GMPCPP; NU-405S, Jena Bioscience) and the solution was incubated for 30 min at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1% Igepal CA-630) after which a click reaction was performed with Sulfo-Cy5-Azide (Jena Bioscience) at the following concentrations ...
-
bioRxiv - Molecular Biology 2021Quote: ... Screening of crystallization conditions was carried out with JBScreen Classic 1 and 2 (Jena Bioscience, Jena, Germany). 2 µl of 9 mg/ml protein solution in 20 mM HEPES-NaOH pH 7.5 and 150 mM NaCl buffer were mixed with an equal volume of reservoir solution and equilibrated against 0.5 ml of reservoir solution ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 % CO2 for 1 h after a final concentration of 500 µM 5-Ethynyluridine (5EU, Jena Bioscience) was added ...
-
bioRxiv - Biophysics 2021Quote: The P3-[1-(2-nitrophenyl)ethyl] ester (NPE) of GTP was obtained from Jena Bioscience (Jena, Germany). P3-[para-hydroxyphenacyl] ester (pHP ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 µM P7/P8 and either 50 µM oxo- dGTP or 1 µM dPTP (Jena Bioscience, Germany). PCR products were DpnI digested for 1 h and 37°C and 5 ng of each product were used for a second PCR ...