Labshake search
Citations for Jena Bioscience :
101 - 150 of 218 citations for 7 Quinolinamine 1 2 3 4 tetrahydro 1 methyl hydrochloride 1 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... and N1-methyladenoside 5’-phosphate (N1-methyl-AMP) was from Jena Bioscience. MTase-Glo™ Methyltransferase Assay Kit containing SAM and SAH were purchased from Promega ...
-
Pathogenic variants of sphingomyelin synthase SMS2 disrupt lipid landscapes in the secretory pathwaybioRxiv - Cell Biology 2022Quote: ... Dried lipid films were click reacted in a 40 μl reaction mix containing 0.45 mM fluorogenic dye 3-azido-7-hydroxycoumarin (Jena Bioscience, CLK-FA047), 1.4 mM Cu(I)tetra(acetonitrile ...
-
bioRxiv - Genomics 2019Quote: ... desthiobiotin-7-dATP (Jena Bioscience) was used in place of biotinylated dUTP for compatibility with the library preparation protocol.
-
bioRxiv - Biophysics 2021Quote: ... Double cycle GMPCPP polymerisation was performed as follows: reconstituted tubulin was supplemented with 1 mM GMPCPP (Jena Biosciences) and incubated for 5 mins on ice ...
-
bioRxiv - Immunology 2020Quote: ... Vero E6 cells were incubated with a 1:500 dilution of an anti-dsRNA J2 antibody (Jena Bioscience) in PBS supplemented with 1% FCS at 4°C overnight with shaking ...
-
bioRxiv - Plant Biology 2023Quote: ... then 5×106 cells were plated on ESAW agar plates containing 450 μg mL-1 nourseothricin (Jena Bioscience), and incubated in constant light at 18 °C.
-
bioRxiv - Biochemistry 2023Quote: ... and GDPCP was assembled in 1×10 buffer by preincubation of eEF1A and GDPCP (Jena Bioscience, Jena, Germany) for 5 minutes at 30°C followed by addition of Ala-tRNAAla for 1 minute at 30°C ...
-
bioRxiv - Biophysics 2019Quote: ... and 6-methyl-tetrazine-PEG5-NHS-ester (Jena Bioscience, Figure S12, Supplementary Information) were conjugated to 3’-amine modified DNA oligos (Integrated DNA Technologies ...
-
bioRxiv - Immunology 2023Quote: ... we site-specifically decorated PS-CFP2 with 6-Methyl-Tetrazine-PEG4Maleimide (Jena Bioscience) and mSav (A106C ...
-
bioRxiv - Neuroscience 2020Quote: ... Endogenous and overexpressed PML was immunofluorescently labelled with anti-PML antibody (rabbit, ABD-030, Jena Bioscience, Germany, 1:500), followed by secondary antibody coupled with STAR 580 STED dye (goat-anti-rabbit ...
-
bioRxiv - Microbiology 2021Quote: ... crescentus ParBΔCTD-CTPɣS complex crystal were also set up in sitting-drop vapour diffusion format in MRC2 96-well crystallization plates with drops comprised of 0.3 µL precipitant solution and 0.3 µL of protein solution (∼10 mg/mL) supplemented with 1 mM CTPɣS (Jena Biosciences) and 1 mM MgCl2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 μl of 40 μM PE* primer and 0.8 μl of 100 μM EvaGreen Fluorescent DNA Stain (Jena Bioscience). The reactions were amplified in a CFX96 Real-Time PCR instrument (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... Single-strand cDNA synthesis was carried out with 1 mg of total RNA using SCRIPT Reverse Transcriptase (Jena Bioscience). qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2023Quote: ... washed extensively with the loading buffer and eluted with the loading buffer supplemented with 1 mM m7GTP (Jena Bioscience). Input ...
-
bioRxiv - Biophysics 2019Quote: ... we site-specifically conjugated PS-CFP2* with 6-Methyl-Tetrazine-PEG4-Maleimide (Jena Bioscience) and the monovalent streptavidin (mSav* ...
-
bioRxiv - Cell Biology 2021Quote: ... 10% Biotinalyted and 65% unlabelled) was polymerised in the presence of 1 mM GMPCPP (NU-405 Jena BioScience, Jena, Germany) at 37 °C for 30 min ...
-
bioRxiv - Biochemistry 2021Quote: ... and DEPTOR (6.8 μM) were preincubated in the presence of 1 mM MgCl2 and 500 μM AMP-PNP (Jena Biosciences) for 20 min and used for cryo-EM grid preparation.
-
bioRxiv - Biochemistry 2021Quote: ... cells were labelled for 20 minutes with EU (5-ethynyl uridine, Jena Bioscience CLK-N002, final concentration at 1 mM). Harvested cells were firstly labeled with Zombie AquaTM (BioLegend ...
-
bioRxiv - Microbiology 2022Quote: ... were prepared for the MluCI and HpaII-digested DNA with mixes were prepared containing 1× ligation buffer (50 mM Tris-HCl pH 7.4 (Jena Bioscience), 10 mM MgCl2 (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2022Quote: ... 150 mM NaCl and time-lapse images were acquired while flowing in 0.3 μM dynamin mixed with 1 mM GTP (Jena Bioscience) and 1 mM MgCl2 in 20 mM HEPES pH 7.4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 68% unlabelled tubulin) for 1 h at 37 ֯C in BRB80 supplemented with 2.7 mM GMPCPP (Jena Bioscience, NU-405). The polymerized microtubules were centrifuged for 30 min at 18000 x g in a Microfuge 18 Centrifuge (Beckman Coulter) ...
-
bioRxiv - Genomics 2024Quote: ... and fragment ends filled-in and biotinylated by adding 27.5 µl of a cocktail containing 15 µL 1 mM biotin-14-dUTP (Jena BioScience), dCTP ...
-
bioRxiv - Biochemistry 2024Quote: ... Then, 0.9 ml of turbo DNase solution (15 mM MgSO4, 10 µg ml−1 turbo DNase (Jena Bioscience, EN-180), 1 mM TCEP and 0.5 mM phenylmethanesulfonyl fluoride ...
-
bioRxiv - Biophysics 2021Quote: ... MTs were prepared either with 0.75 µM mung tubulin or 30 µM goat brain tubulin in BRB-80 buffer with 1 mM GMPCPP (Jena Bioscience, Germany) and incubated at 37°C for 60 min ...
-
bioRxiv - Microbiology 2020Quote: ... The assay was carried out at 37°C and the reaction was started by addition of 1 mM pppGpp (Jena Bioscience), and samples for the nucleotide measurement were taken after 15 min ...
-
bioRxiv - Biochemistry 2020Quote: ... Additives as indicated were added during the primary antibody incubation step at a final concentration of 1 µM for adenosine (Jena Bioscience), AMP (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2020Quote: ... purified naïve C57BL/6 B2 cells were preincubated with a mixture of NIP-OVA and HIV-1 p17/p24/gp120 fusion protein (Jena Biosciences) covalently bound to 1 μm beads (1:1 bead:Bcell ratio ...
-
bioRxiv - Cell Biology 2020Quote: ... For synthesis of the 4sU-labeled spike-ins 1/10 of UTP in the transcription reactions was replaced with 4sUTP (Jena BioScience).
-
bioRxiv - Molecular Biology 2019Quote: ... GMPCPP-stabilized seeds were made by two rounds of polymerization in 25 µM tubulin (40% dig-tubulin) supplemented with 1 mM GMPCPP (Jena Biosciences) as described (Volkov et al. ...
-
bioRxiv - Physiology 2022Quote: ... glycoproteins were enriched using Concanavalin A and azido-modifed proteins were immobilized on magnetic DBCO-beads (Jena Bioscience #CLK-1037-1) via click chemistry ...
-
bioRxiv - Microbiology 2023Quote: ... 500 ng of RNA was reverse-transcribed with gene specific primers (Supplementary information 1) using the SCRIPT cDNA Synthesis Kit (Jena Bioscience) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: On-gel mito-FUNCAT was performed as described previously.72,114 HeLa S3 and MPV17L2 KO #1 cells were cultured in 6-well plates in methionine-free medium with 50 µM HPG (Jena Bioscience) and 100 µg/ml anisomycin (Alomone Labs ...
-
bioRxiv - Biochemistry 2023Quote: ... The chamber was pre-equilibrated with an oxygen scavenger cocktail 32 in 20 mM HEPES pH 7.4 with 150 mM NaCl and time-lapse images were acquired while flowing desired proteins in the same buffer in the absence or presence of 1 mM GTP (Jena Bioscience) and 1 mM MgCl2.
-
bioRxiv - Biochemistry 2021Quote: ... RHEB was preincubated for 1 h with a 30-fold molar excess of GTPγS (Jena Bioscience NU-412-20, lot IT008-18). Next ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then washed again 3x in 1xPBS and then incubated with 5 µM DBCO-488 (Jena Bioscience, CLK-1278-1) at 37 °C for 30 min or 5 µM Click-IT Alexa Fluor® 488 DIBO alkyne dye (ThermoScientific ...
-
bioRxiv - Biochemistry 2023Quote: ... the sequence of corresponding constructs of proLEG were cloned into pLEXSY-sat2.1 vectors and transfected into LEXSY P10 host strain of Leishmania tarentolae cells of the LEXSYcon2.1 expression system (Jena Biosciences, Jena, Germany). The resulting constructs carried N-terminal His6-tags and an N-terminal signal sequence for secretion into the supernatant ...
-
bioRxiv - Developmental Biology 2023Quote: ... After two additional washes the Tn5 was added (1:100) in CUT&Tag med buffer (20 mM HEPES [pH 7.5] (Jena Bioscience, #CSS-511), 300 mM NaCl (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... fluorescently labelled and non-labelled tubulin in a ratio 18:12:70 (total of 20 μM tubulin) with 1 mM GMPCPP (NU-405 Jena BioScience, Jena, Germany) at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... and GTP or GDPCP were assembled in 1×10 buffer with 10 mM βME by preincubation of eEF1A and GTP (PromegaTM Corp., Madison, WI) or GDPCP (Jena Bioscience, Jena, Germany) for 5 minutes at 37°C followed by addition of tRNAAla or Ala-tRNAAla for 1 minute at 37°C and were then kept on ice until use ...
-
Mechanism of actin-dependent activation of nucleotidyl cyclase toxins from bacterial human pathogensbioRxiv - Biochemistry 2021Quote: ... 3’-deoxyadenosine-5’-triphosphate (3’-dATP, Jena Bioscience) at 2 mM and MgCl2 at 4 mM was incubated for 15 minutes at room temperature ...
-
bioRxiv - Biophysics 2019Quote: ... Monomeric PS-CFP2*-AVI-3C-12xHis was site-specifically conjugated with 6-Methyl-Tetrazine-PEG4-Maleimide (Jena Bioscience) to arrive at PS-CFP2*-tetrazine and further processed as described below.
-
bioRxiv - Molecular Biology 2022Quote: ... and 3’deoxy GTP (3′dGTP) from Jena Bioscience.
-
bioRxiv - Biochemistry 2023Quote: ... All exchange experiments reported in this article were initiated by incubation of G-actin (1 µM) with N6-(6-Amino)hexyl-ATP-ATTO-488 (0.1 µM; Jena Bioscience, Germany, ref. NU-805-488) in G+ME buffer (5mM Tris pH 7.5 ...
-
bioRxiv - Cell Biology 2022Quote: Nucleotide binding assays were carried out by measuring the incorporation of 2,3-0-N-Methyl-anthraniloyl (Mant)-labelled nucleotides (Jena Bioscience) using an Synergy2 plate reader (BioTek Instruments Inc. ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 µL 0.4 mM Biotin-7-dATP (Jena Bioscience, NU-835) and 6 µL DNA polymerase 30 Units (Klenow fragment exo-5 U µL−1) ...
-
bioRxiv - Immunology 2024Quote: ... Immunostaining was performed in four steps to avoid unspecific binding of the secondary antibodies: i) incubation overnight at 4LJ with the mouse monoclonal IgG2a J2 antibody anti-dsRNA (Jena Bioscience, cat. RNT-SCI-10010500, dilution 1:200), ii ...
-
bioRxiv - Biophysics 2022Quote: ... The 2’-deoxy-ATP labeled with N-Methylanthraniloyl at the 3’-ribose position (mantATP) was also purchased from Jena Biosciences (10 mM stock). ATP and ADP were prepared from powder (MilliporeSigma ...
-
bioRxiv - Cell Biology 2022Quote: ... 7 μM of biotinylated tubulin and 0.5 mM GMPCPP (Jena Bioscience, NU-405S) in BRB80 buffer was incubated at 37°C for 40 min ...
-
bioRxiv - Biochemistry 2021Quote: ... [Ta6Br12]2+ * 2 Br– (Jena Bioscience) for 1 to 5 days ...
-
bioRxiv - Biophysics 2021Quote: ... were polymerized from 4 mg/ml tubulin for 2 h at 37 °C in BRB80 supplemented with 1mM MgCl2 and 1mM GMPCPP (Jena Bioscience, NU-405). The polymerized microtubules were centrifuged for 30 min at 18000 x g in a Microfuge 18 Centrifuge (Beckman Coulter) ...