Labshake search
Citations for Jena Bioscience :
101 - 150 of 180 citations for 6 Octen 1 ol 3 7 dimethyl 1 formate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... The tubulin mix (20 μM) with 1 mM GMPCPP (NU-405L; Jena Bioscience) in BRB80 (80 mM Pipes pH 6.9 ...
-
bioRxiv - Biophysics 2023Quote: ... in the presence of 1 mM GMPCPP (NU-405L, Jena Bioscience, Jena, Germany) was prepared at 37 °C to nucleate short microtubule seeds ...
-
bioRxiv - Biophysics 2024Quote: ... 1 MgCl2 and labeled in 300 nM of pyrimidyl-tetrazine-Alexa647 (JENA Biosciences) for 15-20 minutes ...
-
bioRxiv - Physiology 2023Quote: ... the supernatant was incubated with 150 μl 6% (v/v) Nickel-IDA agarose bead suspension (Jena Bioscience) for 2 hours at 4 °C under mild agitation ...
-
bioRxiv - Cell Biology 2019Quote: ... at a total tubulin concentration of 20 µM with 1 mM GMPCPP (Jena Biosciences) at 37° C for 30 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... nascent peptides within mitochondria were labeled with 1 μM azide-conjugated Cy3 (Jena Bioscience) with a Click-it Cell Reaction Buffer Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2019Quote: ... Cy3 labeled 2’/3’-O-(2-aminoethyl-carbamoyl)-adenosine-5’-triphosphate (Jena Bioscience) was added into the imaging buffer instead of ATP.
-
bioRxiv - Cell Biology 2023Quote: The in vitro transcribed RNAs were 3’ biotinylated using pCp-Biotin (Jena Biosciences). Briefly ...
-
bioRxiv - Biochemistry 2023Quote: ... The pre-tRNAs were 3’ biotinylated with pCp-biotin (750 µM; Jena Bioscience) and T4 RNA ligase (2 units/µl) ...
-
bioRxiv - Biochemistry 2019Quote: ... Cytarabine-TP (NU- 1170S) and N6-(6-Aminohexyl)-ATP-6FAM (NU-805-6FM) were purchased from Jena Bioscience.
-
bioRxiv - Biophysics 2019Quote: ... Monomeric PS-CFP2*-AVI-3C-12xHis was site-specifically conjugated with 6-Methyl-Tetrazine-PEG4-Maleimide (Jena Bioscience) to arrive at PS-CFP2*-tetrazine and further processed as described below.
-
bioRxiv - Biochemistry 2020Quote: ... incubated with 50 μg/ml of lysozyme and 6 U of RNase-free DNase I (Jena Bioscience, Germany) at room temperature for 30 min ...
-
bioRxiv - Biophysics 2019Quote: ... at a total final tubulin concentration of 20 µM with 1 mM GMPCPP (Jena Biosciences) at 37°C for 30 minutes ...
-
bioRxiv - Biophysics 2020Quote: ... Tubulin solutions were mixed with 1 µl 10 mM GMP-CPP (#NU-405S, Jena Bioscience) on ice and incubated for 10 minutes to allow nucleotide exchange ...
-
bioRxiv - Molecular Biology 2021Quote: ... Ribosome–EF-G complexes were applied to EM grids (Quantifoil 3.5/1 μm, Jena Bioscience) covered with pre-floated continuous carbon ...
-
bioRxiv - Biochemistry 2022Quote: ... The first crystals were found in several solutions of JB Screen Classic 1 (Jena Bioscience); for example ...
-
bioRxiv - Immunology 2023Quote: ... 1 µg/ml of recombinant YF17D-DIII or TBEV-DIII (Jena Bioscience, PR-1450-S) was used ...
-
bioRxiv - Cancer Biology 2023Quote: ... The concentrated RHEB was then incubated with 1 mM GMPPNP (Jena Bioscience NU-401-50) for 60 min at 4 °C and the protein was flash frozen in liquid nitrogen and stored at -80 °C.
-
bioRxiv - Biochemistry 2022Quote: ... To assemble microtubules stabilized with guanylyl-(a,(3)-methylene-diphosphonate (GMP-CPP) (Jena Bioscience), tubulin was diluted to 2 mg/mL in BRB80 buffer supplemented with 0.5 mM GMP-CPP ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells migrating in microfluidic devices were pulsed with 1 mM 5-ethynyl uridine (EU, Jena Bioscience) in complete DMEM for 4 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 mg of azide coupled bivalent Nb was incubated with 0.5 mL DBCO-Agarose (Jena Bioscience) slurry for 4 h at 25 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The sample-covered carbon was then adsorbed to an EM grid (Quantifoil R3.5/1, Jena Bioscience) and blotted for 9 s using a Vitrobot Mark IV (ThermoFisher ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified by PCR in the presence of 1:5 Digoxigenin-11-dUTP:dTTP (Jena Bioscience, Germany) using primers CD21 and CD26 (Supplementary Table 1) ...
-
bioRxiv - Plant Biology 2022Quote: ... Prepared samples were mixed with Regeneration agar containing nourseothricin (300 μg.ml-1, Jena BioScience, pNDN-OGG) or hygromycin (100 μg.ml-1 ...
-
bioRxiv - Biophysics 2023Quote: ... pH 7.4) with 1 mM guanosine-5’-[(α,β)-methyleno]triphosphate (GMPCPP; NU-405S, Jena Bioscience) and the solution was incubated for 30 min at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... Female genomic probe was labelled with Cy3-dUTP (cyanine 3-deoxyuridine triphosphate; Jena Bioscience, Germany) by nick translation ...
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: The fluorescence of 3’-O-(N-Methyl-anthraniloyl)-2’-deoxyadenosine-5’-triphosphate (mantATP) (Jena Biosciences) was measured with 290 nm excitation and a 395 nm long-pass emission filter in a stopped-flow apparatus (Applied Photophysics ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1% Igepal CA-630) after which a click reaction was performed with Sulfo-Cy5-Azide (Jena Bioscience) at the following concentrations ...
-
bioRxiv - Molecular Biology 2021Quote: ... Screening of crystallization conditions was carried out with JBScreen Classic 1 and 2 (Jena Bioscience, Jena, Germany). 2 µl of 9 mg/ml protein solution in 20 mM HEPES-NaOH pH 7.5 and 150 mM NaCl buffer were mixed with an equal volume of reservoir solution and equilibrated against 0.5 ml of reservoir solution ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 % CO2 for 1 h after a final concentration of 500 µM 5-Ethynyluridine (5EU, Jena Bioscience) was added ...
-
bioRxiv - Biophysics 2021Quote: The P3-[1-(2-nitrophenyl)ethyl] ester (NPE) of GTP was obtained from Jena Bioscience (Jena, Germany). P3-[para-hydroxyphenacyl] ester (pHP ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 µM P7/P8 and either 50 µM oxo- dGTP or 1 µM dPTP (Jena Bioscience, Germany). PCR products were DpnI digested for 1 h and 37°C and 5 ng of each product were used for a second PCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... short oligo DNAs for each target (see Supplementary Table 6) were pooled and labelled with 5-Propargylamino-ddUTP-Cy3 or -Cy5 (Jena Biosciences) using the Terminal Deoxynucleotidyl Transferase (Thermo Fisher)52 ...
-
bioRxiv - Biochemistry 2020Quote: ... 3’dGTP and cytidine-5’-[(α,β)-methyleno]triphosphate (CMPCPP) were from Jena Bioscience (Jena, Germany); 2’dGTP ...
-
bioRxiv - Biophysics 2021Quote: ... Double cycle GMPCPP polymerisation was performed as follows: reconstituted tubulin was supplemented with 1 mM GMPCPP (Jena Biosciences) and incubated for 5 mins on ice ...
-
bioRxiv - Immunology 2020Quote: ... Vero E6 cells were incubated with a 1:500 dilution of an anti-dsRNA J2 antibody (Jena Bioscience) in PBS supplemented with 1% FCS at 4°C overnight with shaking ...
-
bioRxiv - Plant Biology 2023Quote: ... then 5×106 cells were plated on ESAW agar plates containing 450 μg mL-1 nourseothricin (Jena Bioscience), and incubated in constant light at 18 °C.
-
bioRxiv - Biochemistry 2023Quote: ... and GDPCP was assembled in 1×10 buffer by preincubation of eEF1A and GDPCP (Jena Bioscience, Jena, Germany) for 5 minutes at 30°C followed by addition of Ala-tRNAAla for 1 minute at 30°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Endogenous and overexpressed PML was immunofluorescently labelled with anti-PML antibody (rabbit, ABD-030, Jena Bioscience, Germany, 1:500), followed by secondary antibody coupled with STAR 580 STED dye (goat-anti-rabbit ...
-
bioRxiv - Microbiology 2021Quote: ... crescentus ParBΔCTD-CTPɣS complex crystal were also set up in sitting-drop vapour diffusion format in MRC2 96-well crystallization plates with drops comprised of 0.3 µL precipitant solution and 0.3 µL of protein solution (∼10 mg/mL) supplemented with 1 mM CTPɣS (Jena Biosciences) and 1 mM MgCl2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 μl of 40 μM PE* primer and 0.8 μl of 100 μM EvaGreen Fluorescent DNA Stain (Jena Bioscience). The reactions were amplified in a CFX96 Real-Time PCR instrument (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... Single-strand cDNA synthesis was carried out with 1 mg of total RNA using SCRIPT Reverse Transcriptase (Jena Bioscience). qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2023Quote: ... washed extensively with the loading buffer and eluted with the loading buffer supplemented with 1 mM m7GTP (Jena Bioscience). Input ...
-
bioRxiv - Cell Biology 2021Quote: ... 10% Biotinalyted and 65% unlabelled) was polymerised in the presence of 1 mM GMPCPP (NU-405 Jena BioScience, Jena, Germany) at 37 °C for 30 min ...
-
bioRxiv - Biochemistry 2021Quote: ... and DEPTOR (6.8 μM) were preincubated in the presence of 1 mM MgCl2 and 500 μM AMP-PNP (Jena Biosciences) for 20 min and used for cryo-EM grid preparation.
-
bioRxiv - Biochemistry 2021Quote: ... cells were labelled for 20 minutes with EU (5-ethynyl uridine, Jena Bioscience CLK-N002, final concentration at 1 mM). Harvested cells were firstly labeled with Zombie AquaTM (BioLegend ...
-
bioRxiv - Microbiology 2022Quote: ... were prepared for the MluCI and HpaII-digested DNA with mixes were prepared containing 1× ligation buffer (50 mM Tris-HCl pH 7.4 (Jena Bioscience), 10 mM MgCl2 (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2022Quote: ... 150 mM NaCl and time-lapse images were acquired while flowing in 0.3 μM dynamin mixed with 1 mM GTP (Jena Bioscience) and 1 mM MgCl2 in 20 mM HEPES pH 7.4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 68% unlabelled tubulin) for 1 h at 37 ֯C in BRB80 supplemented with 2.7 mM GMPCPP (Jena Bioscience, NU-405). The polymerized microtubules were centrifuged for 30 min at 18000 x g in a Microfuge 18 Centrifuge (Beckman Coulter) ...
-
bioRxiv - Genomics 2024Quote: ... and fragment ends filled-in and biotinylated by adding 27.5 µl of a cocktail containing 15 µL 1 mM biotin-14-dUTP (Jena BioScience), dCTP ...