Labshake search
Citations for Jena Bioscience :
51 - 100 of 101 citations for Human Short Coiled Coil Protein SCOC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... A sequencing ladder was generated using the DNA Cycle Sequencing kit (Jena Bioscience) according to the manufacturer’s recommendations with the CJnc230 sRNA region amplified from NCTC11168 WT (CSS-5295 ...
-
bioRxiv - Microbiology 2019Quote: The Click Chemistry labelling system “CuAAC Biomolecule Reaction Buffer Kit (THPTA based)” (Jena Bioscience) was used following manufacturer’s instructions [51] ...
-
bioRxiv - Microbiology 2020Quote: ... A DNA sequencing ladder was generated using a DNA cycle Sequencing Kit (Jena Bioscience) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... A sequencing ladder was also constructed using the DNA Cycle sequencing kit (Jena Bioscience) according to the manufacturer’s instructions with the CJnc180/190 region amplified with primers CSO-0354/0355 from genomic DNA (NCTC11168 wild-type ...
-
bioRxiv - Molecular Biology 2023Quote: ... for GTP analog treated samples Non-hydrolyzable GTP Test Kit (Jena Bioscience #NK-102) containing 5 analogs – GTPαS ...
-
bioRxiv - Molecular Biology 2022Quote: ... we performed click chemistry using the CuAAC Biomolecule Reaction Buffer Kit-BTTAA based (Jena Biosciences). Following click chemistry ...
-
bioRxiv - Plant Biology 2024Quote: ... The Cy5 probe was generated using the HighYield T7 Cy5 RNA Labelling Kit (Jena Bioscience) with a T7-gfp PCR product as template ...
-
bioRxiv - Plant Biology 2019Quote: Fluorescent labeling of dsRNA was performed using the Atto 488 RNA Labeling Kit (Jena Bioscience, Jena, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... dUTP-ATTO-550 or dUTP-ATTO-488 using a nick translation labelling kit (Jena Bioscience, http://www.jenabioscience.com).
-
bioRxiv - Molecular Biology 2021Quote: ... 4 samples each) were extracted with CHAPS Lysis buffer from the Click Chemistry Capture Kit (Jena Bioscience). Input cell numbers were adjusted to give similar amount of total injected peptides ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA from each clone was labeled through nick translation with either the Atto550 NT Labeling Kit (Jena Bioscience) or the Digoxigenin NT Labeling Kit (Jena Bioscience) ...
-
bioRxiv - Plant Biology 2021Quote: Fluorescence labeling of SaMIF1-dsRNA was performed using the HighYield T7 AF488 RNA Labeling Kit (Jena Bioscience, Germany) following the manufacturer’s instruction ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... probes were labelled by nick translation with Cy3-dUTP using Cy3 NT Labeling Kit (Jena Bioscience, Jena, Germany). In this case ...
-
bioRxiv - Genomics 2019Quote: ... 1ug phosphorylated oligo was incubated with reagents from the CuAAC Biomolecule Reaction Buffer kit (Jena Bioscience CLK-072) and 250uM azide for 1h at 37C ...
-
bioRxiv - Molecular Biology 2021Quote: ... in vitro transcription was performed using the HighYield T7 Cy3 RNA Labelling Kit (Jena Bioscience, RNT-101-CY3) in accordance to the instructions of the manufacturer ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: Random mutagenesis was carried out in a 50 µl reaction with the JBS dNTP-Mutagenesis Kit (Jena Bioscience) with 5 µM dNTP analogs ...
-
bioRxiv - Genetics 2023Quote: ... The entire plasmids were labeled by nick translation using a Cy3 NT Labeling Kit (Jena Bioscience, Jena, Germany). For the final probe mixture preparation ...
-
bioRxiv - Systems Biology 2023Quote: ... followed by column purification (Zebaspin RNA clean&concentrator kit) and subsequent coupling to DBCO-PEG12-TCO (Jena Biosciences) at 1:5 molar ratio overnight at room temperature ...
-
bioRxiv - Genetics 2021Quote: ... the PCR labelling Cy-3 and Cy-5 kits (Jena Bioscience, ref# PP-301L-Cy3 and #APP-101-Cy5) according to the manufacturer’s instructions with M13 universal primers ...
-
bioRxiv - Biochemistry 2020Quote: ... affinity chromatography of CDPK1 pre-incubated with the compounds was performed by utilizing ATP Affinity Test Kit (Jena Bioscience). Protocol was followed as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2019Quote: All PCR products with the expected size were purified using the SAP-Exo Kit (Jena Bioscience GmbH, Jena, Germany) and Sanger sequenced from both directions by LGC Genomics (Berlin ...
-
bioRxiv - Systems Biology 2022Quote: ... All cell stocks were regularly checked for absence of mycoplasma with the Mycoplasma Detection Kit (Jena Bioscience; # PP-401).
-
bioRxiv - Genomics 2023Quote: ... Mycoplasma was tested to be negative for all cellular input reported using Mycoplasma Detection Kit (Jena Bioscience PP-401) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: Cell lines are regularly checked for the absence of Mycoplasma using a PCR based detection kit (Jena Biosciences PP-401).
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were tested at least once in two months for Mycoplasma contamination using Mycoplasma Detection Kit (Jena Bioscience PP-401L).
-
bioRxiv - Evolutionary Biology 2023Quote: ... In-vitro transcription was conducted with HighYield T7 Cap 1 AG (3‘-OMe) mRNA Synthesis Kit (m5CTP) (Jena Bioscience, Germany) using 800 ng of amplified template followed by Turbo DNase treatment (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... mESCs were checked once during cultivation for Mycoplasma contamination using a PCR-based mycoplasma detection kit (Jena Bioscience #PP-401L) as indicated by the manufacturer.
-
bioRxiv - Molecular Biology 2024Quote: ... In vitro transcription was performed using a T7-Scribe Standard RNA IVT Kit (CELLSCRIPT) in the presence of 1.2 mM BrUTP (Jena Bioscience) and 5 mM UTP ...
-
bioRxiv - Molecular Biology 2024Quote: ... In vitro transcription was performed using a T7-Scribe Standard RNA IVT Kit (CELLSCRIPT) in the presence of 1.2 mM BrUTP (Jena Bioscience) and 5 mM UTP ...
-
bioRxiv - Molecular Biology 2021Quote: T7 promoter containing double stranded DNA was used as a template for in vitro transcription with HighYield T7 mRNA Synthesis Kit (ac4CTP) (Jena Bioscience) (sense strand 5’ GTACGGTAATACGACTCACTATAGGGAGTGGTCTACACACATGACAGAATGGGGCAGGTCCGTAATCGGTTGCAGAGCGGTTACCGATCTCATCGC 3’ and antisense strand 5’ GGCCGCGATGAGATCGGTAACCGCTCTGCAACCGATTACGGACCTGCCCCATTCTGTCATGTGTGTAGACCACTCCCTATAGTGAGTCGTATTACC 3’) ...
-
bioRxiv - Microbiology 2019Quote: ... mt COI and ap ORF470 of the expected size were purified using the SAP-Exo Kit (Jena Bioscience GmbH, Jena, Germany), and sequenced in both directions by LGC Genomics (Berlin ...
-
bioRxiv - Cell Biology 2019Quote: HA-photocholesterol complexes were then clicked to Pico-azido picolyl sulfo cy3 by using the CuAAC Biomolecule Reaction Buffer Kit (Jena Bioscience). Samples were subjected to SDS-PAGE and HA-photocholesterol was visualized using the Typhoon FLA 9500 scanner (Excitation =555 nm ...
-
bioRxiv - Microbiology 2021Quote: ... The assay was performed as per kit instructions using a Tecan Spark 10M multimode plate reader and ATP (nM) was determined using the ATP (Jena Bioscience) standard curve produced.
-
bioRxiv - Microbiology 2020Quote: ... denatured for 3 min at 90°C and subjected to separation using a denaturing 8% sequencing gel in presence of a RyeG-specific sequencing ladder prepared using the DNA Cycle Sequencing kit (Jena Bioscience) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Simultaneous in situ hybridization included Nick-translation labelled genomic DNA from barley (AF594 NT Labeling Kit, PP-305L-AF594, Jena Bioscience) and the TRS-probe (AF488 NT Labeling Kit ...
-
bioRxiv - Plant Biology 2022Quote: ... and protease inhibitor cocktail) and incubated with nucleotide-linked agarose beads (AMP and ATP affinity test kits, Jena Biosciences, Jena, Germany) overnight on the wheel at 4°C at a final concentration of 0.2% ß-DM ...
-
bioRxiv - Microbiology 2023Quote: ... 500 ng of RNA was reverse-transcribed with gene specific primers (Supplementary information 1) using the SCRIPT cDNA Synthesis Kit (Jena Bioscience) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... The entire plasmid was used as a template for nick translation using a Cy3 NT Labeling Kit (Jena Bioscience, Jena, Germany). For the final probe mixture preparation ...
-
bioRxiv - Molecular Biology 2023Quote: T7 promoter containing double stranded DNA (Supplementary Table 3) was used as a template for in vitro transcription with HighYield T7 mRNA Synthesis Kit (ac4CTP) (Jena Bioscience).
-
bioRxiv - Physiology 2023Quote: ... and cDNA was synthesised from 2 µg of RNA by reverse transcription (SCRIPT cDNA Synthesis Kit, Jena Bioscience GmBH, Jena, Germany). Gene expression assays for Il1b (Rn00580432_m1) ...
-
bioRxiv - Microbiology 2024Quote: ... of 5’-triphosphate (PPP) Qβ-RNA and RNAI was performed in a 20 µL scale using the HighYield T7 RNA Synthesis Kit (Jena Bioscience) according to manufacturer’s instructions in the presence of 1 µg dsDNA template ...
-
bioRxiv - Immunology 2023Quote: ... and first PCR reaction was performed on 1 µl of a 1 in 100 diluted freeze-thawed cell pellet using the SCRIPT HF RT-PCR Kit (Jena Bioscience), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 100% m6A modified full-length PAN transcript was synthesized using the MEGAscript T7 Transcription Kit following the manufacturer’s protocol but substituting adenosine-triphosphate with N6-methyladenosine-5’-triphosphate (Jena Bioscience NU-1101S). RNAs were purified using the MEGAclear Transcription Clean-Up Kit (ThermoFisher AM1908).
-
bioRxiv - Biophysics 2021Quote: ... initial crystallization conditions were screened on sitting-drop Greiner 609120 96-well plates using a Honeybee963 robot (Digilab) and commercial kits from Jena Bioscience (Jena) and Hampton Research (Aliso Viejo ...
-
bioRxiv - Plant Biology 2022Quote: ... Purified PCR products and plasmid DNAs were labeled with ATTO488-dUTP or ATTO550-dUTP using Fluorescent Nick Translation Labeling kits (Jena Bioscience, Germany).
-
bioRxiv - Evolutionary Biology 2023Quote: ... and the PCR products were labeled with Atto550-dUTP (red) or Atto488-dUTP (green) according to the manufacturer’s recommendations using the Nick-Translation mix kit (Jena Bioscience, Jena, Germany). The probes were then hybridized in all other Alligatoridae species according to the methodology reported by Yano et al ...
-
bioRxiv - Physiology 2024Quote: ... All cell stocks were regularly checked for absence of mycoplasma with the Mycoplasma Detection Kit (Jena Bioscience, Jena, Thüringen, Germany, #PP-401).
-
bioRxiv - Plant Biology 2020Quote: ... The lysate was cleared by centrifugation and RNA was extracted using RNA purification kit as described by the manufacture (Jena Bioscience, PP-210), followed by DNase I treatment ...
-
bioRxiv - Biochemistry 2022Quote: Initial crystallization conditions for P9-1ΔC-arm were screened at room temperature on 96-well sitting-drop Greiner 609120 plates using a Digilab Honeybee963 robot (Marlborough, USA) and commercial kits from Jena Bioscience (Jena, Germany) and Hampton Research (Aliso Viejo ...
-
bioRxiv - Molecular Biology 2022Quote: ... single crystals were then soaked for 2 hours at 18°C in a solution containing 1 mM (Ta6Br12)2+ cluster (JBS Tantalum Cluster Derivatization Kit from Jena Bioscience GmbH, Jena, Germany). 25% glycerol cryo-protected native crystals or 50/50 paratone/paraffin oil mixture cryo-protected derivative crystals were flash-frozen in liquid nitrogen.