Labshake search
Citations for Jena Bioscience :
51 - 100 of 117 citations for Human Endothelin 2 EDN2 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... GMPPNP binding Irgb6 crystals diffracting to 1.6 Å resolution were obtained from sitting drops with a 9 mg/ml protein solution containing 2 mM GMPPNP (Jena Bioscience) and a reservoir solution consisting of 0.1 M Sodium citrate buffer pH 5.6 ...
-
bioRxiv - Immunology 2023Quote: ... the SPAAC (strain-promoted azide-alkyne cycloaddition) click chemistry reaction was employed by incubating azide-coupled Nbs with 2-fold molar excess of DBCO-AF647 (Jena Bioscience) for 2 h at 25°C ...
-
bioRxiv - Cell Biology 2024Quote: ... were polymerized from 4 mg/ml tubulin for 2 h at 37°C in BRB80 supplemented with 1mM MgCl2 and 1mM GMPCPP (#NU-405, Jena Bioscience). The polymerized microtubules were centrifuged for 30 min at 18000 x g in a Microfuge 18 Centrifuge (Beckman Coulter) ...
-
bioRxiv - Cancer Biology 2021Quote: To fluorescently label IVT RNA the ATTO647N RNA labelling kit (Jena Bioscience) was used ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was isolated using the Total RNA Purification Kit (Jena Biosciences) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... primer extension was performed using the DNA cycle sequencing kit (Jena Bioscience), 150 ng digested DNA and 32P-end-labelled oligonucleotides according to the manufacturer protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Atto488 or Atto550 fluorophores by a nick translation labelling kit (Jena Bioscience).
-
bioRxiv - Biophysics 2021Quote: Tubulin polymerization kinetics were measured for concentrations ranging betwee 0.25 µM and 2 µM were polymerized by incubation with BRB-80 buffer containing 10% glycerol and either 1 mM GTP (Jena Bioscience, Germany) with 1 mM MgCl2 or 10 µM taxol ...
-
bioRxiv - Molecular Biology 2019Quote: ... and incubated for 2 hours at 37°C in the absence or presence of N6-methyladenosine (Jena Biosciences, Cat no. NU-1101L) to generate ‘body-labeled’ m6A-RNAs ...
-
bioRxiv - Biochemistry 2022Quote: Guanine nucleotide exchange activity was measured by following changes in the fluorescence of the GDP derivative mant-dGDP [2’-Deoxy-3’-O-(N-Methyl-anthraniloyl) guanosine-5’-diphosphate sodium salt (Jena Bioscience GmbH)] (Margarit et al. ...
-
bioRxiv - Biophysics 2021Quote: ... were polymerized from 4 mg/ml tubulin for 2 h at 37 °C in BRB80 supplemented with 1mM MgCl2 and 1mM GMPCPP (Jena Bioscience, NU-405). The polymerized microtubules were centrifuged for 30 min at 18000 x g in a Microfuge 18 Centrifuge (Beckman Coulter) ...
-
bioRxiv - Biophysics 2022Quote: ... The 2’-deoxy-ATP labeled with N-Methylanthraniloyl at the 3’-ribose position (mantATP) was also purchased from Jena Biosciences (10 mM stock). ATP and ADP were prepared from powder (MilliporeSigma ...
-
bioRxiv - Zoology 2020Quote: ... in which a third of the dTTP had been replaced with Digoxigenin-X-(5-aminoallyl)-2’-deoxyuridine-5’-triphosphate (Jena Bioscience, Jena, Germany) for 40 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... A sequencing ladder was generated using the DNA Cycle Sequencing kit (Jena Bioscience) according to the manufacturer’s recommendations with the CJnc230 sRNA region amplified from NCTC11168 WT (CSS-5295 ...
-
bioRxiv - Cell Biology 2021Quote: ... kept for 2 h in DMEM to remove remaining TCO*K and were labeled with 1 µM Tet-Cy3 (Jena Bioscience, CLK-014-05) or Tet-BDP-FL (Jena Bioscience ...
-
bioRxiv - Microbiology 2019Quote: The Click Chemistry labelling system “CuAAC Biomolecule Reaction Buffer Kit (THPTA based)” (Jena Bioscience) was used following manufacturer’s instructions [51] ...
-
bioRxiv - Microbiology 2020Quote: ... A DNA sequencing ladder was generated using a DNA cycle Sequencing Kit (Jena Bioscience) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... A sequencing ladder was also constructed using the DNA Cycle sequencing kit (Jena Bioscience) according to the manufacturer’s instructions with the CJnc180/190 region amplified with primers CSO-0354/0355 from genomic DNA (NCTC11168 wild-type ...
-
bioRxiv - Molecular Biology 2023Quote: ... for GTP analog treated samples Non-hydrolyzable GTP Test Kit (Jena Bioscience #NK-102) containing 5 analogs – GTPαS ...
-
bioRxiv - Genetics 2021Quote: ... or under amino acid-selective conditions in complete supplemental medium (CSM) (Difco yeast nitrogen extract without amino acids, amino acid powder from Sunrise Science Products, 2% μg/ml nourseothricin (Jena Bioscience, Jena, Germany) and 2 mM methionine was used to select strains containing pBV65 vector derivatives (42) ...
-
bioRxiv - Molecular Biology 2022Quote: ... we performed click chemistry using the CuAAC Biomolecule Reaction Buffer Kit-BTTAA based (Jena Biosciences). Following click chemistry ...
-
bioRxiv - Plant Biology 2024Quote: ... The Cy5 probe was generated using the HighYield T7 Cy5 RNA Labelling Kit (Jena Bioscience) with a T7-gfp PCR product as template ...
-
bioRxiv - Plant Biology 2019Quote: Fluorescent labeling of dsRNA was performed using the Atto 488 RNA Labeling Kit (Jena Bioscience, Jena, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... dUTP-ATTO-550 or dUTP-ATTO-488 using a nick translation labelling kit (Jena Bioscience, http://www.jenabioscience.com).
-
bioRxiv - Molecular Biology 2021Quote: ... 4 samples each) were extracted with CHAPS Lysis buffer from the Click Chemistry Capture Kit (Jena Bioscience). Input cell numbers were adjusted to give similar amount of total injected peptides ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA from each clone was labeled through nick translation with either the Atto550 NT Labeling Kit (Jena Bioscience) or the Digoxigenin NT Labeling Kit (Jena Bioscience) ...
-
bioRxiv - Plant Biology 2021Quote: Fluorescence labeling of SaMIF1-dsRNA was performed using the HighYield T7 AF488 RNA Labeling Kit (Jena Bioscience, Germany) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: C15-az and C17-az modified proteins were pulled down using the Click Chemistry Capture Kit (Jena Bioscience) and alkyne agarose beads (Jena Bioscience) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... probes were labelled by nick translation with Cy3-dUTP using Cy3 NT Labeling Kit (Jena Bioscience, Jena, Germany). In this case ...
-
bioRxiv - Genomics 2019Quote: ... 1ug phosphorylated oligo was incubated with reagents from the CuAAC Biomolecule Reaction Buffer kit (Jena Bioscience CLK-072) and 250uM azide for 1h at 37C ...
-
bioRxiv - Molecular Biology 2021Quote: ... in vitro transcription was performed using the HighYield T7 Cy3 RNA Labelling Kit (Jena Bioscience, RNT-101-CY3) in accordance to the instructions of the manufacturer ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: Random mutagenesis was carried out in a 50 µl reaction with the JBS dNTP-Mutagenesis Kit (Jena Bioscience) with 5 µM dNTP analogs ...
-
bioRxiv - Genetics 2023Quote: ... The entire plasmids were labeled by nick translation using a Cy3 NT Labeling Kit (Jena Bioscience, Jena, Germany). For the final probe mixture preparation ...
-
bioRxiv - Systems Biology 2023Quote: ... followed by column purification (Zebaspin RNA clean&concentrator kit) and subsequent coupling to DBCO-PEG12-TCO (Jena Biosciences) at 1:5 molar ratio overnight at room temperature ...
-
bioRxiv - Genetics 2021Quote: ... the PCR labelling Cy-3 and Cy-5 kits (Jena Bioscience, ref# PP-301L-Cy3 and #APP-101-Cy5) according to the manufacturer’s instructions with M13 universal primers ...
-
bioRxiv - Biochemistry 2020Quote: ... affinity chromatography of CDPK1 pre-incubated with the compounds was performed by utilizing ATP Affinity Test Kit (Jena Bioscience). Protocol was followed as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2019Quote: All PCR products with the expected size were purified using the SAP-Exo Kit (Jena Bioscience GmbH, Jena, Germany) and Sanger sequenced from both directions by LGC Genomics (Berlin ...
-
bioRxiv - Systems Biology 2022Quote: ... All cell stocks were regularly checked for absence of mycoplasma with the Mycoplasma Detection Kit (Jena Bioscience; # PP-401).
-
bioRxiv - Genomics 2023Quote: ... Mycoplasma was tested to be negative for all cellular input reported using Mycoplasma Detection Kit (Jena Bioscience PP-401) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: Cell lines are regularly checked for the absence of Mycoplasma using a PCR based detection kit (Jena Biosciences PP-401).
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were tested at least once in two months for Mycoplasma contamination using Mycoplasma Detection Kit (Jena Bioscience PP-401L).
-
bioRxiv - Evolutionary Biology 2023Quote: ... In-vitro transcription was conducted with HighYield T7 Cap 1 AG (3‘-OMe) mRNA Synthesis Kit (m5CTP) (Jena Bioscience, Germany) using 800 ng of amplified template followed by Turbo DNase treatment (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... mESCs were checked once during cultivation for Mycoplasma contamination using a PCR-based mycoplasma detection kit (Jena Bioscience #PP-401L) as indicated by the manufacturer.
-
bioRxiv - Molecular Biology 2024Quote: ... In vitro transcription was performed using a T7-Scribe Standard RNA IVT Kit (CELLSCRIPT) in the presence of 1.2 mM BrUTP (Jena Bioscience) and 5 mM UTP ...
-
bioRxiv - Molecular Biology 2024Quote: ... In vitro transcription was performed using a T7-Scribe Standard RNA IVT Kit (CELLSCRIPT) in the presence of 1.2 mM BrUTP (Jena Bioscience) and 5 mM UTP ...
-
bioRxiv - Molecular Biology 2021Quote: T7 promoter containing double stranded DNA was used as a template for in vitro transcription with HighYield T7 mRNA Synthesis Kit (ac4CTP) (Jena Bioscience) (sense strand 5’ GTACGGTAATACGACTCACTATAGGGAGTGGTCTACACACATGACAGAATGGGGCAGGTCCGTAATCGGTTGCAGAGCGGTTACCGATCTCATCGC 3’ and antisense strand 5’ GGCCGCGATGAGATCGGTAACCGCTCTGCAACCGATTACGGACCTGCCCCATTCTGTCATGTGTGTAGACCACTCCCTATAGTGAGTCGTATTACC 3’) ...
-
bioRxiv - Microbiology 2019Quote: ... mt COI and ap ORF470 of the expected size were purified using the SAP-Exo Kit (Jena Bioscience GmbH, Jena, Germany), and sequenced in both directions by LGC Genomics (Berlin ...
-
bioRxiv - Cell Biology 2019Quote: HA-photocholesterol complexes were then clicked to Pico-azido picolyl sulfo cy3 by using the CuAAC Biomolecule Reaction Buffer Kit (Jena Bioscience). Samples were subjected to SDS-PAGE and HA-photocholesterol was visualized using the Typhoon FLA 9500 scanner (Excitation =555 nm ...
-
bioRxiv - Microbiology 2021Quote: ... The assay was performed as per kit instructions using a Tecan Spark 10M multimode plate reader and ATP (nM) was determined using the ATP (Jena Bioscience) standard curve produced.
-
bioRxiv - Microbiology 2020Quote: ... denatured for 3 min at 90°C and subjected to separation using a denaturing 8% sequencing gel in presence of a RyeG-specific sequencing ladder prepared using the DNA Cycle Sequencing kit (Jena Bioscience) according to the manufacturer’s instructions ...