Labshake search
Citations for Beckman :
101 - 150 of 1223 citations for ssc mir 17 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... amplicons were purified after each PCR step using the Agencourt AMPure XP purification kit (Beckman Coulter Inc., Brea, USA), and amplicon fragment size and quantification were checked using a Bioanalyzer (Agilent ...
-
bioRxiv - Microbiology 2020Quote: ... and the resulting cDNA was PCR amplified (11 cycles) and purified using the Agencourt AMPure XP kit (Beckman Coulter Genomics). For Illumina NextSeq sequencing ...
-
bioRxiv - Physiology 2019Quote: ... Agencourt AMPure XP PCR purification kit (5 ml Beckman Coulter Part No. A63880; 60 ml Beckman Coulter Part No. A63881) was used ...
-
bioRxiv - Immunology 2021Quote: ... The first PCR reaction was purified using the AMPure Size Select Magnetic Bead Kit at a ratio of 0.6X (Beckman Coulter). Amplicon libraries were then prepared according to the Pacific Biosciences Multiplex SMRT Sequencing protocol and sequenced on a Pacific Biosciences Sequel platform (Pacific Biosciences ...
-
bioRxiv - Molecular Biology 2024Quote: ... The initial PCR products of rbcL F3R3 were purified using an Agencourt AMPure XP kit (Beckman Coulter, Fullerton, CA, USA). To construct the DNA libraries for the second PCR ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR clean-up was performed with Agencourt AMPure XP PCR Purification beads (Beckman Coulter Life Sciences ...
-
bioRxiv - Molecular Biology 2019Quote: ... The concentrated urine sample was resuspended in 3.2 ml of a 50% iodixanol solution and layered on the bottom of a 17 ml Thinwall Polypropylene Tube (Beckman Coulter, Fullerton, California, USA). A discontinuous DG was prepared by additional layering of 4 ml of 20% ...
-
bioRxiv - Cell Biology 2020Quote: ... the samples were thawed at RT and transferred to centrifuge tubes (357003, Beckman Coulter) and centrifuged at 10 000 g in an Avanti J-26 XPI centrifuge (Beckman Coulter ...
-
bioRxiv - Microbiology 2020Quote: ... PCR product was purified using AMPure XP for PCR Purification (Beckman Coulter Indianapolis, IN), quantified using Qubit dsDNA HS Assay Kit (ThermoFisher Waltham ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR products were purified using the AMPure XP PCR purification system (Beckman Coulter, A63881) and the 96S Super Magnet (Alpaqua ...
-
bioRxiv - Genomics 2023Quote: ... the PCR products were isolated using an AMPure XP PCR purification beads (Beckman Coulter). Indexed amplicons were then generated using a Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Bioengineering 2024Quote: ... the PCR products were isolated using an AMPure XP PCR purification beads (Beckman Coulter). Indexed amplicons were then generated with a Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were tagged using barcodes NB01 to NB05 of the Native Barcoding Expansion 1-12 PCR-free kit (EXP-NBD104, ONT) and purified using Agencourt AMPure XP beads (Beckman Coulter). The barcoded samples were quantified using a Qubit fluorometer and pooled equimolarly to reach 700 ng in 65 μL ...
-
bioRxiv - Genomics 2019Quote: ... The resulting PCR reactions were pooled and purified (first using the minElute PCR purification kit of Qiagen, followed by an extra purification step using AMPureXP beads of Beckman Coulter), and the amplified cDNA quantified on a BioAnalyzer High Sensitivity Chip (Agilent) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The amplified DNA was purified using a Qiagen MinElute PCR Purification Kit and primer dimers (<100 bp) were removed using AMPure beads (Beckman Coulter). ATAC-Seq was performed with two biological repeats to ensure the robustness of the data sets ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The PCR amplicons of the samples were then pooled after a purification and concentration equalization process with the AMPureXP Kit (Beckman Coulter). The libraries were processed in an Illumina MiSeq v2 (500 cycles and paired-end).
-
bioRxiv - Evolutionary Biology 2024Quote: ... PCR products were purified using Qiagen MinElute PCR purification kit and size-selected (∼30-280 bp) using Ampure XP beads (Beckman Coulter). Reporter plasmid libraries were made by cloning amplified ATAC fragments into AgeI-HF- and SalI-HF-linearized pSTARR-seq plasmid using InFusion HD cloning kit (Takara ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products from thew first PCR were individually purified using 0.6X volumes of AMPure XP magnetic beads (AMPure XP beads kit / Beckman coulter, USA), followed by a second PCR reaction to attach the dual indices (S5 and N7 ...
-
bioRxiv - Immunology 2023Quote: ... Final PCR reaction was then purified with a MinElute PCR Purification Kit followed by size-selection (150bp-1000bp using Ampure XP beads, Beckman Coulter). Sequencing was performed using a MGISEQ-2000 (BGI Tech Solutions) ...
-
bioRxiv - Microbiology 2023Quote: ... The growth curves were measured at OD595 using the PARADIG detection platform (Beckman, United States) or Sunrise absorbance microplate reader (Tecan ...
-
bioRxiv - Developmental Biology 2023Quote: ... Five PCR cycles were run and PCR products were purified using AMPure XP reagent (Beckman Coulter Life Sciences ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR cleanup was performed after the final PCR step by AMPure XP beads (Beckman Coulter). The concentration and purity of final PCR products was determined by Qubit and Bioanalyzer2100.
-
bioRxiv - Biophysics 2023Quote: ... the solution was centrifuged at 3500 rpm (Sorvall Legend RT, Beckman Coulter Inc. Indianapolis, IN), the supernatant oil phase was carefully removed ...
-
bioRxiv - Biophysics 2023Quote: ... the solution was centrifuged at 3500 rpm (Sorvall Legend RT, Beckman Coulter Inc. Indianapolis, IN), the oil phase was carefully removed ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR products were purified with the kit from Agencourt AMPuer XPsystem (Cat. No. A63880, Beckman Coulter, South San Francisco, CA, USA), and the purified products were used with the second PCR amplification ...
-
bioRxiv - Microbiology 2022Quote: ... The V4 region of 16S rRNA gene was amplified using the universal primer set 515F and 806R.27 PCR products were cleaned up with an AMPure XP kit (Beckman Coulter, CA), followed by electrophoresis on 0.7% agarose gel and 1.15% Synergel (Diversified Biotech ...
-
bioRxiv - Microbiology 2019Quote: PCR products not requiring gel excision were purified after PCR using AMPure XP beads (Beckman Coulter) at a ratio of 1.2:1 beads:product ...
-
bioRxiv - Cancer Biology 2022Quote: ... after which PCR products were purified using Agencourt Ampure XP PCR Purification Beads obtained from Beckman Coulter (Cat ...
-
bioRxiv - Genomics 2019Quote: ... Modified fragmentation time and AMPure XP beads (Beckman Coulter, CA, USA) selection procedure were applied to generate shorter library fragments for sequencing ...
-
bioRxiv - Immunology 2023Quote: ... PCR products were sequenced by Beckman Coulter or Genewiz.
-
bioRxiv - Immunology 2023Quote: ... and the detection of neutrophils was carried out using 13-color flow cytometer CytoFLEX system (Beckman Coulter Life Sciences CytoFLEX benchtop flow cytometer ...
-
bioRxiv - Microbiology 2019Quote: ... PCR clean-up: 25 µL PCR product was mixed with AMPure XP beads (Beckman Coulter Genomic, USA), and incubated for 5 min ...
-
bioRxiv - Systems Biology 2020Quote: ... PCR products were size selected and cleaned up using AMPure XP PCR Purification solution (Beckman Coulter™). After purification ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... one half was purified using silica columns (MinElute PCR Purification Kit) and the other using 3x SPRI beads (Beckman Coulter™ Agencourt AMPure XP). Indexing PCR ...
-
bioRxiv - Microbiology 2022Quote: ... The success of the amplifications was checked in a 2% agarose gel and PCR products were subsequently purified using Agencourt AMPure XP magnetic beads kit (Beckman Coulter, Brea, CA, USA), quantified with the QuantiFluor™ dsDNA System (Promega ...
-
bioRxiv - Genomics 2019Quote: ... Libraries were purified one more time with SPRI Beads (Beckman Coulter, 1.5x). Libraries were quantified using a Qubit fluorometer (Life technologies ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were purified one more time with SPRISelect reagent (Beckman Coulter, 1.5x). Libraries were quantified using a Qubit fluorimeter (Life technologies ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 72 times the volume of Ampure XP beads (Beckman Coulter #A63881). Library quality was assessed using a BioAnalyzer 2100 High Sensitivity DNA Chip (Agilent Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... for 45 min at RT and subjected to flow cytometric analysis with a CytoFLEX flow cytometer (Beckman). The results were analysed by FlowJo (version 10 ...
-
bioRxiv - Microbiology 2021Quote: ... The amplified PCR product was purified and size selected using the AMPure XP PCR Cleanup system (Beckman Coulter). Barcoded products were pooled in equimolar concentrations and send for paired-end Illumina sequencing (2×250 bp HiSeq2500 ...
-
bioRxiv - Microbiology 2021Quote: ... Any amplicon contaminated with traces of non-specific fragments was further purified using the Agencourt AMPure™ PCR purification kit (Beckman Coulter, Beverly, MA, USA). The concentration of each PCR amplicon was determined using the Quant-iT™ PicoGreen kit (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR reaction was purified and size selected using Agencourt AMPure XP-PCR magnetic beads (Beckman Coulter, Pasadena, CA). Each sample was quantified using the Qubit fluorometeric system (Thermo-Fisher ...
-
bioRxiv - Genomics 2021Quote: ... PCR was then performed using the SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT) and then cDNA purified using AMPure beads (Beckman Coulter). In order to achieve a high concentration of cDNA the input was subjected to 25 cycles of PCR amplification ...
-
bioRxiv - Neuroscience 2023Quote: ... CE/MS detection was applied with the coupling of PA800 plus CE system (Beckman Coulter, Brea, CA, USA) and mass spectrometry (TRIPLE QUAD 5500 ...
-
bioRxiv - Immunology 2022Quote: ... GEM-RT products were subsequently amplified using human BCR primers and cleaned up through SPRIselect beads (Beckman Coulter). Next ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were washed 3 times and analyzed with MoFlo (Beckman, Brea, CA, USA) and associated software ...
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR product was purified by Agencourt Ampure XP PCR Purification beads per the manufacturer’s protocol (Beckman Coulter, Brea, CA). One microgram of Cas9 plasmid and 0.3 μg of each gRNA gBlock (pair ...
-
bioRxiv - Cell Biology 2020Quote: ... After purification of the PCR product with a 1: 0.6 ratio of PCR product to AMPure XP beads (Beckman Coulter), the success of cDNA preparation was confirmed using a 2100 Bioanalyzer with High-sensitivity DNA chip (Agilent) ...
-
bioRxiv - Microbiology 2019Quote: ... including library amplification for 15 PCR cycles using custom indexed primers and post-PCR clean-up with 0.85x volume Ampure XP (Beckman Coulter). Libraries were quantified using Quant-iT PicoGreen dsDNA Assay Kit (Invitrogen ...
-
bioRxiv - Pathology 2023Quote: ... Ligated cDNAs were amplified following 15 PCR cycles and PCR products were purified using AMPure XP Beads (Beckman Coulter Genomics). Libraries were validated using a Bioanalyzer on a DNA1000 chip (Agilent ...