Labshake search
Citations for Beckman :
1 - 50 of 952 citations for PCR Plates since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... PCR plates were loaded using the Biomek FX liquid handling robot (Beckman Coulter) and reactions [10 ng cDNA ...
-
bioRxiv - Immunology 2023Quote: ... the PCR plate was briefly centrifuged and 25 µl of room-temperature AMPure XP beads (1:1 ratio; Beckman Coulter) was added to each well and incubated for 8 minutes at room temperature ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The PCR products were analyzed with 2% agarose gel and transferred into 96-well PCR plate wells for clean-up with 20 µL of AMPure XP beads (Beckman Coulter #A63881) according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 20 μL reactions were prepared by dispensing 1 μL of each 10 μM reverse primer into the wells of a 96-well PCR plate using the Echo liquid handler (Beckman Coulter, Brea, CA). A mastermix consisting of polymerase premix ...
-
bioRxiv - Bioengineering 2023Quote: ... two Plate Delliders (Beckman Coulter), one CapitAll IS Automated Capper/Decapper (Thermo Fisher) ...
-
bioRxiv - Genetics 2019Quote: ... Three PCR reactions were pooled and the PCR product was purified using the Agencourt AMPure XP PCR purification kit (Beckman Coulter) and sequenced using MiSeq (Illumina).
-
bioRxiv - Biochemistry 2022Quote: ... Fluorescence was measured in 384-well plates on a DTX 880 Multimode Plate Reader (Beckman Coulter) with λex = 485 nm and λem= 535 nm.
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were purified by the AMPure XP PCR-Cleanup Kit (Beckman Coulter); DNA concentrations were measured by the Qubit Quant-iT dsDNA HS Assay Kit (Thermo Fischer Scientific) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR clean-up was performed with Agencourt AMPure XP PCR Purification beads (Beckman Coulter Life Sciences ...
-
bioRxiv - Microbiology 2020Quote: ... PCR product was purified using AMPure XP for PCR Purification (Beckman Coulter Indianapolis, IN), quantified using Qubit dsDNA HS Assay Kit (ThermoFisher Waltham ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR products were purified using the AMPure XP PCR purification system (Beckman Coulter, A63881) and the 96S Super Magnet (Alpaqua ...
-
bioRxiv - Genomics 2023Quote: ... the PCR products were isolated using an AMPure XP PCR purification beads (Beckman Coulter). Indexed amplicons were then generated using a Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR products were purified using the Agencourt AMPure XP PCR purification kit (Beckman Coulter), following the manufacturer protocol ...
-
bioRxiv - Bioengineering 2024Quote: ... the PCR products were isolated using an AMPure XP PCR purification beads (Beckman Coulter). Indexed amplicons were then generated with a Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... The products of the PCR reaction with Agencourt AMPure XP PCR purification kit (Beckman Coulter). The deep sequencing was performed by Nextera Miseq reagent micro kit v2 by MiSeq platform (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Five PCR cycles were run and PCR products were purified using AMPure XP reagent (Beckman Coulter Life Sciences ...
-
bioRxiv - Genomics 2023Quote: ... The second PCR products were purified using Agencourt AMPure XP PCR purification kit (Beckman Coulter). We performed pair-end sequencing on Illumina NextSeq platforms with 30% balanced DNA (phiX).
-
bioRxiv - Molecular Biology 2024Quote: ... PCR cleanup was performed after the final PCR step by AMPure XP beads (Beckman Coulter). The concentration and purity of final PCR products was determined by Qubit and Bioanalyzer2100.
-
bioRxiv - Evolutionary Biology 2020Quote: The PCR product was cleaned with Agencourt AMPure XP-PCR Purification Kit (Beckman Coulter, Indianapolis, USA), following the manufacturer’s instruction with some modifications ...
-
bioRxiv - Microbiology 2019Quote: PCR products not requiring gel excision were purified after PCR using AMPure XP beads (Beckman Coulter) at a ratio of 1.2:1 beads:product ...
-
bioRxiv - Cancer Biology 2022Quote: ... after which PCR products were purified using Agencourt Ampure XP PCR Purification Beads obtained from Beckman Coulter (Cat ...
-
bioRxiv - Immunology 2023Quote: ... PCR products were sequenced by Beckman Coulter or Genewiz.
-
bioRxiv - Developmental Biology 2024Quote: ... Compounds for screening were picked from source plates and transferred to assay plates using an Echo 555 acoustic transfer liquid handler (Labcyte/Beckman). Each drug was tested at a concentration of 1 µM directly added in the Hashimoto plate ...
-
bioRxiv - Microbiology 2019Quote: ... PCR clean-up: 25 µL PCR product was mixed with AMPure XP beads (Beckman Coulter Genomic, USA), and incubated for 5 min ...
-
bioRxiv - Systems Biology 2020Quote: ... PCR products were size selected and cleaned up using AMPure XP PCR Purification solution (Beckman Coulter™). After purification ...
-
bioRxiv - Biochemistry 2022Quote: ... NanoGlo luciferase assay substrate was prepared at a 1:100 dilution according to manufacturer’s protocol and 3 μl NanoGlo substrate was added to each well of media transfer plate and cell source plate with a BioRAPTR FRD (Beckman Coulter). Nanoluciferase luminescence for each plate was read on a ViewLux plate reader (PerkinElmer ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were transferred from 96-well plates into 384-well plates using a Biomek FX Automated Workstation (Beckman Coulter, model A31843). Each plasmid was pipetted into 4 consecutive wells within the 384-well plate ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we purified the product of the second PCR reaction with Agencourt AMPure XP PCR purification kit (Beckman Coulter). We performed sequencing on MiSeq or NextSeq platforms (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... The amplified PCR product was purified and size selected using the AMPure XP PCR Cleanup system (Beckman Coulter). Barcoded products were pooled in equimolar concentrations and send for paired-end Illumina sequencing (2×250 bp HiSeq2500 ...
-
bioRxiv - Immunology 2023Quote: ... cells were activated with plate-bound anti-CD3 (500 ng/one well of 24-well culture plate; Beckman Coulter, REF# IM-1304) and soluble anti-CD28 (500 ng/ml ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR reaction was purified and size selected using Agencourt AMPure XP-PCR magnetic beads (Beckman Coulter, Pasadena, CA). Each sample was quantified using the Qubit fluorometeric system (Thermo-Fisher ...
-
bioRxiv - Genomics 2021Quote: ... PCR was then performed using the SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT) and then cDNA purified using AMPure beads (Beckman Coulter). In order to achieve a high concentration of cDNA the input was subjected to 25 cycles of PCR amplification ...
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR product was purified by Agencourt Ampure XP PCR Purification beads per the manufacturer’s protocol (Beckman Coulter, Brea, CA). One microgram of Cas9 plasmid and 0.3 μg of each gRNA gBlock (pair ...
-
bioRxiv - Cell Biology 2020Quote: ... After purification of the PCR product with a 1: 0.6 ratio of PCR product to AMPure XP beads (Beckman Coulter), the success of cDNA preparation was confirmed using a 2100 Bioanalyzer with High-sensitivity DNA chip (Agilent) ...
-
bioRxiv - Microbiology 2019Quote: ... including library amplification for 15 PCR cycles using custom indexed primers and post-PCR clean-up with 0.85x volume Ampure XP (Beckman Coulter). Libraries were quantified using Quant-iT PicoGreen dsDNA Assay Kit (Invitrogen ...
-
bioRxiv - Pathology 2023Quote: ... Ligated cDNAs were amplified following 15 PCR cycles and PCR products were purified using AMPure XP Beads (Beckman Coulter Genomics). Libraries were validated using a Bioanalyzer on a DNA1000 chip (Agilent ...
-
bioRxiv - Genetics 2023Quote: ... PCR products were purified with the Qiagen MinElute PCR Purification Kit and AMPure XP beads (Beckman Coulter, Cat. No. A63880) and resuspended in ultrapure nuclease-free distilled water ...
-
bioRxiv - Genetics 2021Quote: ... PCR products were purified using SPRIselect beads (Beckman) (bead to sample ratio 0.8) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were purified (AMPure XP system, Beckman Coulter Life Sciences ...
-
bioRxiv - Plant Biology 2022Quote: ... Purified PCR products (Beckman and Coulter AMPure XP) were used for a second PCR to ligate Illumina adapters ...
-
bioRxiv - Genetics 2023Quote: ... PCR products were purified using magnetic beads (Beckman) or a QIAquick PCR Purification Kit (Qiagen ...
-
bioRxiv - Immunology 2024Quote: ... PCR amplification was followed by SPRI (Beckman Coulter) size selection to exclude fragments larger than 1,200 bp ...
-
bioRxiv - Immunology 2021Quote: ... isolated CD4+ cells were activated with a combination of plate-bound anti-CD3 (750 ng/24-well culture plate well; Immunotech/Beckman Coulter REF # IM-1304) and soluble anti-CD28 ((1ug/mL ...
-
bioRxiv - Microbiology 2023Quote: ... for 24 hours in a microtiter plate reader (Beckman DTX880) at 37°C.
-
bioRxiv - Microbiology 2019Quote: ... The first and second PCR reaction products were purified using AMPure XP PCR product cleanup and size selection kit (Beckman Coulter), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... The pooled and normalized PCR reactions were purified using 1.8x the PCR reaction volume of AMPure XP beads (Beckman Coulter Inc). Samples were prepared for sequencing on Illumina MiSeq using the manufacturer’s standard library preparation protocol ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products from mouse samples were gel purified whereas PCR products from ferret samples were purified with paramagnetic beads using the AMPure XP for PCR Purification kit (Beckman Coulter). Purified PCR products were used in a second PCR reaction for incorporating sample-specific 5’-end indexes and additional Illumina sequencing adapters (Supplementary Table 2) ...
-
bioRxiv - Microbiology 2020Quote: ... The first and second PCR reaction products were purified using AMPure XP PCR product cleanup and size selection kit (Beckman Coulter), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR templates were purified using Agencourt AMPure XP (PCR product: AMPure XP beads = 1:0.8; Beckman Coulter, Brea, California, USA) before the second PCR ...
-
bioRxiv - Immunology 2022Quote: ... nested PCR of the TCR locus was performed following the purification of PCR product by an AM Pure XP kit (Beckman Coulter) at a 0.7:1 ratio of beads to sample and eluted with 20 μL of 10 mM Tris-HCl (pH 8.0) ...