Labshake search
Citations for Beckman :
1 - 50 of 944 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... PCR products were size selected and cleaned up using AMPure XP PCR Purification solution (Beckman Coulter™). After purification ...
-
bioRxiv - Genetics 2022Quote: ... We cleaned the PCR product with 1.8x volume of Agencourt® AMPure® XP magnetic bead solution (Beckman Coulter, Brea, CA, USA), and suspended in 40µL elution buffer (Qiagen ...
-
bioRxiv - Bioengineering 2024Quote: ... PCR products were isolated using AMPure XP PCR purification beads (Beckman Coulter). Indexed amplicons were generated using a Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were purified by the AMPure XP PCR-Cleanup Kit (Beckman Coulter); DNA concentrations were measured by the Qubit Quant-iT dsDNA HS Assay Kit (Thermo Fischer Scientific) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR clean-up was performed with Agencourt AMPure XP PCR Purification beads (Beckman Coulter Life Sciences ...
-
bioRxiv - Microbiology 2022Quote: CsCl linear gradients were prepared by overlaying 8.5 mL of 1.46 g/cm3 CsCl solution with 8.5 mL of 1.2 g/cm3 CsCl solution in 17 mL Ultra-Clear tubes (Beckman Coulter), which were then spun at a 45-degree angle and a speed of 20 rpm for 13.5 minutes using Gradient Master (BioComp).
-
bioRxiv - Microbiology 2020Quote: ... PCR product was purified using AMPure XP for PCR Purification (Beckman Coulter Indianapolis, IN), quantified using Qubit dsDNA HS Assay Kit (ThermoFisher Waltham ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR products were purified using the AMPure XP PCR purification system (Beckman Coulter, A63881) and the 96S Super Magnet (Alpaqua ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR products were purified using the Agencourt AMPure XP PCR purification kit (Beckman Coulter), following the manufacturer protocol ...
-
bioRxiv - Bioengineering 2024Quote: ... the PCR products were isolated using an AMPure XP PCR purification beads (Beckman Coulter). Indexed amplicons were then generated with a Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... the PCR products were isolated using an AMPure XP PCR purification beads (Beckman Coulter). Indexed amplicons were then generated using a Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Plant Biology 2024Quote: ... The second PCR contained 6 µL of purified PCR product (using SPRIselect beads; Beckman Coulter Life Sciences ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR cleanup was performed after the final PCR step by AMPure XP beads (Beckman Coulter). The concentration and purity of final PCR products was determined by Qubit and Bioanalyzer2100.
-
bioRxiv - Microbiology 2023Quote: ... The products of the PCR reaction with Agencourt AMPure XP PCR purification kit (Beckman Coulter). The deep sequencing was performed by Nextera Miseq reagent micro kit v2 by MiSeq platform (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... The second PCR products were purified using Agencourt AMPure XP PCR purification kit (Beckman Coulter). We performed pair-end sequencing on Illumina NextSeq platforms with 30% balanced DNA (phiX).
-
bioRxiv - Developmental Biology 2024Quote: ... Five PCR cycles were run and PCR products were purified using AMPure XP reagent (Beckman Coulter Life Sciences ...
-
bioRxiv - Pathology 2020Quote: ... 50 μl of Truecount bead solution (Beckman Coulter) was added to each sample ...
-
bioRxiv - Evolutionary Biology 2020Quote: The PCR product was cleaned with Agencourt AMPure XP-PCR Purification Kit (Beckman Coulter, Indianapolis, USA), following the manufacturer’s instruction with some modifications ...
-
bioRxiv - Cancer Biology 2022Quote: ... after which PCR products were purified using Agencourt Ampure XP PCR Purification Beads obtained from Beckman Coulter (Cat ...
-
bioRxiv - Immunology 2023Quote: ... PCR products were sequenced by Beckman Coulter or Genewiz.
-
bioRxiv - Plant Biology 2024Quote: AmPure XP for PCR Purification (Beckman Coulter Life Sciences ...
-
bioRxiv - Biophysics 2021Quote: ... The density gradient was prepared by layering 4.5 mL of 30.4 % urografin solution on top of 4.5 mL of 53.2 % urografin solution in an ultra-clear centrifuge tube (Beckman Coulter; catalogue number 344059). The tubes were left at room temperature (25 °C ...
-
bioRxiv - Immunology 2020Quote: ... resuspended in VersaLyse solution (Beckman Coulter, catalog number A09777) with 2.5% Fixative Solution (Beckman Coulter ...
-
bioRxiv - Immunology 2020Quote: ... with 2.5% Fixative Solution (Beckman Coulter, catalog number A07800) and incubated 15 min at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... with 2.5% Fixative Solution (Beckman Coulter, catalog number A07800), samples were further incubated for 15 min at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... The amplified PCR product was purified and size selected using the AMPure XP PCR Cleanup system (Beckman Coulter). Barcoded products were pooled in equimolar concentrations and send for paired-end Illumina sequencing (2×250 bp HiSeq2500 ...
-
bioRxiv - Cell Biology 2023Quote: ... pelleted SVF was resuspended in VersaLyse solution (Beckman Coulter #A09777) according to the manufacturer’s recommendations and washed once with 1% albumin solution ...
-
bioRxiv - Genomics 2021Quote: ... PCR was then performed using the SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT) and then cDNA purified using AMPure beads (Beckman Coulter). In order to achieve a high concentration of cDNA the input was subjected to 25 cycles of PCR amplification ...
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR product was purified by Agencourt Ampure XP PCR Purification beads per the manufacturer’s protocol (Beckman Coulter, Brea, CA). One microgram of Cas9 plasmid and 0.3 μg of each gRNA gBlock (pair ...
-
bioRxiv - Cell Biology 2020Quote: ... After purification of the PCR product with a 1: 0.6 ratio of PCR product to AMPure XP beads (Beckman Coulter), the success of cDNA preparation was confirmed using a 2100 Bioanalyzer with High-sensitivity DNA chip (Agilent) ...
-
bioRxiv - Pathology 2023Quote: ... Ligated cDNAs were amplified following 15 PCR cycles and PCR products were purified using AMPure XP Beads (Beckman Coulter Genomics). Libraries were validated using a Bioanalyzer on a DNA1000 chip (Agilent ...
-
bioRxiv - Genetics 2023Quote: ... PCR products were purified with the Qiagen MinElute PCR Purification Kit and AMPure XP beads (Beckman Coulter, Cat. No. A63880) and resuspended in ultrapure nuclease-free distilled water ...
-
bioRxiv - Genetics 2021Quote: ... PCR products were purified using SPRIselect beads (Beckman) (bead to sample ratio 0.8) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were purified (AMPure XP system, Beckman Coulter Life Sciences ...
-
bioRxiv - Plant Biology 2022Quote: ... Purified PCR products (Beckman and Coulter AMPure XP) were used for a second PCR to ligate Illumina adapters ...
-
bioRxiv - Immunology 2024Quote: ... PCR amplification was followed by SPRI (Beckman Coulter) size selection to exclude fragments larger than 1,200 bp ...
-
bioRxiv - Genetics 2023Quote: ... PCR products were purified using magnetic beads (Beckman) or a QIAquick PCR Purification Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: PCR products were purified using Ampure Beads (Beckman) following manufacturer instructions and Sanger sequenced at the RML Research Technologies Section ...
-
bioRxiv - Biophysics 2021Quote: ... were purified using an Agencourt AMPure XP bead solution (Beckman Coulter) and a magnetic rack ...
-
bioRxiv - Biophysics 2021Quote: ... The collected solution was transferred to Ti-45 ultracentrifuge tubes (Beckman) and the volume brought up to 50mL with buffer A ...
-
bioRxiv - Immunology 2020Quote: ... pellet was resuspended with VersaLyse Lysing Solution (Beckman Coulter S.r.l., Milano) for 20 min at room temperature in the dark ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and the lymphocytes fixed (25 μl of Fixative Solution, Beckman Coulter). The samples were mixed and incubated for 10 minutes in the darkness ...
-
bioRxiv - Cancer Biology 2020Quote: ... The pooled and normalized PCR reactions were purified using 1.8x the PCR reaction volume of AMPure XP beads (Beckman Coulter Inc). Samples were prepared for sequencing on Illumina MiSeq using the manufacturer’s standard library preparation protocol ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products from mouse samples were gel purified whereas PCR products from ferret samples were purified with paramagnetic beads using the AMPure XP for PCR Purification kit (Beckman Coulter). Purified PCR products were used in a second PCR reaction for incorporating sample-specific 5’-end indexes and additional Illumina sequencing adapters (Supplementary Table 2) ...
-
bioRxiv - Microbiology 2020Quote: ... The first and second PCR reaction products were purified using AMPure XP PCR product cleanup and size selection kit (Beckman Coulter), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR templates were purified using Agencourt AMPure XP (PCR product: AMPure XP beads = 1:0.8; Beckman Coulter, Brea, California, USA) before the second PCR ...
-
bioRxiv - Immunology 2022Quote: ... nested PCR of the TCR locus was performed following the purification of PCR product by an AM Pure XP kit (Beckman Coulter) at a 0.7:1 ratio of beads to sample and eluted with 20 μL of 10 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Microbiology 2021Quote: ... The first and second PCR reaction products were purified using AMPure XP PCR product cleanup and size selection kit (Beckman Coulter), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR amplification was then performed using the SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT) and cDNA was subsequently purified using AMPure beads (Beckman Coulter). The library was split and a further 20 or 25 PCR cycles were performed using a biotin oligonucleotide (5—PCBioTACACGACGCTCTTCCGATCT ...
-
bioRxiv - Genomics 2023Quote: ... PCR amplification was then performed using the SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT) and cDNA was subsequently purified using AMPure beads (Beckman Coulter). The library was split and a further 20 or 25 PCR cycles were performed using a biotin oligonucleotide (5—PCBio-TACACGACGCTCTTCCGATCT ...