Labshake search
Citations for Beckman :
101 - 150 of 1240 citations for ssc mir 323 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... Libraries were purified one more time with SPRI Beads (Beckman Coulter, 1.5x). Libraries were quantified using a Qubit fluorometer (Life technologies ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were purified one more time with SPRISelect reagent (Beckman Coulter, 1.5x). Libraries were quantified using a Qubit fluorimeter (Life technologies ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 72 times the volume of Ampure XP beads (Beckman Coulter #A63881). Library quality was assessed using a BioAnalyzer 2100 High Sensitivity DNA Chip (Agilent Technologies) ...
-
bioRxiv - Microbiology 2021Quote: ... The amplified PCR product was purified and size selected using the AMPure XP PCR Cleanup system (Beckman Coulter). Barcoded products were pooled in equimolar concentrations and send for paired-end Illumina sequencing (2×250 bp HiSeq2500 ...
-
bioRxiv - Microbiology 2020Quote: ... for 45 min at RT and subjected to flow cytometric analysis with a CytoFLEX flow cytometer (Beckman). The results were analysed by FlowJo (version 10 ...
-
bioRxiv - Microbiology 2021Quote: ... Any amplicon contaminated with traces of non-specific fragments was further purified using the Agencourt AMPure™ PCR purification kit (Beckman Coulter, Beverly, MA, USA). The concentration of each PCR amplicon was determined using the Quant-iT™ PicoGreen kit (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR reaction was purified and size selected using Agencourt AMPure XP-PCR magnetic beads (Beckman Coulter, Pasadena, CA). Each sample was quantified using the Qubit fluorometeric system (Thermo-Fisher ...
-
bioRxiv - Genomics 2021Quote: ... PCR was then performed using the SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT) and then cDNA purified using AMPure beads (Beckman Coulter). In order to achieve a high concentration of cDNA the input was subjected to 25 cycles of PCR amplification ...
-
bioRxiv - Neuroscience 2023Quote: ... CE/MS detection was applied with the coupling of PA800 plus CE system (Beckman Coulter, Brea, CA, USA) and mass spectrometry (TRIPLE QUAD 5500 ...
-
bioRxiv - Immunology 2022Quote: ... GEM-RT products were subsequently amplified using human BCR primers and cleaned up through SPRIselect beads (Beckman Coulter). Next ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were washed 3 times and analyzed with MoFlo (Beckman, Brea, CA, USA) and associated software ...
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR product was purified by Agencourt Ampure XP PCR Purification beads per the manufacturer’s protocol (Beckman Coulter, Brea, CA). One microgram of Cas9 plasmid and 0.3 μg of each gRNA gBlock (pair ...
-
bioRxiv - Cell Biology 2020Quote: ... After purification of the PCR product with a 1: 0.6 ratio of PCR product to AMPure XP beads (Beckman Coulter), the success of cDNA preparation was confirmed using a 2100 Bioanalyzer with High-sensitivity DNA chip (Agilent) ...
-
bioRxiv - Microbiology 2019Quote: ... including library amplification for 15 PCR cycles using custom indexed primers and post-PCR clean-up with 0.85x volume Ampure XP (Beckman Coulter). Libraries were quantified using Quant-iT PicoGreen dsDNA Assay Kit (Invitrogen ...
-
bioRxiv - Pathology 2023Quote: ... Ligated cDNAs were amplified following 15 PCR cycles and PCR products were purified using AMPure XP Beads (Beckman Coulter Genomics). Libraries were validated using a Bioanalyzer on a DNA1000 chip (Agilent ...
-
bioRxiv - Genetics 2021Quote: ... PCR products were purified using SPRIselect beads (Beckman) (bead to sample ratio 0.8) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were purified (AMPure XP system, Beckman Coulter Life Sciences ...
-
bioRxiv - Plant Biology 2022Quote: ... Purified PCR products (Beckman and Coulter AMPure XP) were used for a second PCR to ligate Illumina adapters ...
-
bioRxiv - Immunology 2024Quote: ... PCR amplification was followed by SPRI (Beckman Coulter) size selection to exclude fragments larger than 1,200 bp ...
-
bioRxiv - Genetics 2023Quote: ... PCR products were purified using magnetic beads (Beckman) or a QIAquick PCR Purification Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: PCR products were purified using Ampure Beads (Beckman) following manufacturer instructions and Sanger sequenced at the RML Research Technologies Section ...
-
bioRxiv - Cancer Biology 2023Quote: ... visualized by excitation with 561nm laser and emission detection with 585/42 filter using the Cytoflex S (Beckman Coulter). MSCs cultured with DiI-labeled ALL cells without transwell were used as control ...
-
bioRxiv - Cancer Biology 2020Quote: ... The pooled and normalized PCR reactions were purified using 1.8x the PCR reaction volume of AMPure XP beads (Beckman Coulter Inc). Samples were prepared for sequencing on Illumina MiSeq using the manufacturer’s standard library preparation protocol ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR templates were purified using Agencourt AMPure XP (PCR product: AMPure XP beads = 1:0.8; Beckman Coulter, Brea, California, USA) before the second PCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR amplification was then performed using the SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT) and cDNA was subsequently purified using AMPure beads (Beckman Coulter). The library was split and a further 20 or 25 PCR cycles were performed using a biotin oligonucleotide (5—PCBioTACACGACGCTCTTCCGATCT ...
-
bioRxiv - Genomics 2023Quote: ... PCR amplification was then performed using the SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT) and cDNA was subsequently purified using AMPure beads (Beckman Coulter). The library was split and a further 20 or 25 PCR cycles were performed using a biotin oligonucleotide (5—PCBio-TACACGACGCTCTTCCGATCT ...
-
bioRxiv - Cancer Biology 2023Quote: ... The PCR products in the two groups were mixed and were purified using the Agencourt AMPure XP PCR purification system (Beckman Coulter).
-
bioRxiv - Microbiology 2021Quote: ... and centrifuged each time at 4000 × g for 15 min (Microfuge 20R, Beckman Coulter) followed by resuspension in PBS.
-
bioRxiv - Bioengineering 2021Quote: ... Samples were then washed three times and analyzed via flow cytometry (CytoFlex, Beckman Coulter).
-
bioRxiv - Cancer Biology 2024Quote: ... Library preparation for sequencing was performed using a two-step amplification (junction PCR followed by sequencing-ready PCR) and cleaned using SPRIselect beads (Beckman cat. B23318). Sequencing was done with Azenta.
-
bioRxiv - Microbiology 2024Quote: ... Infected red blood cells were distinguished from non-infected by detection of the fluorescence emitted by the cytoplasmic GFP of the parasite and were quantified by cytometry (CytoFLEX S, Beckman). 250,000-500,000 events were recorded.
-
bioRxiv - Genomics 2022Quote: ... PCR amplicons were cleaned with AmpureXP beads (#A63882; Beckman Coulter Life Sciences ...
-
bioRxiv - Genomics 2019Quote: ... Following PCR clean-up with Ampure (Beckman, Agencourt USA), a sequencing reaction was set up using 1.0 μl of Big dye ...
-
bioRxiv - Microbiology 2020Quote: All PCR reactions were purified using RNAClean XP (Beckman Coulter ...
-
bioRxiv - Genetics 2020Quote: ... PCR products were purified using Ampure XP (Beckman Coulter) and Sanger sequenced (Genewiz ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were cleaned using AmpureXP beads (Beckman Coulter) and sequenced on an Illumina NextSeq 500 using a custom sequencing primer ...
-
bioRxiv - Genomics 2022Quote: ... PCR products were purified using AMPure beads (Beckman Coulter) and sent for Sanger sequencing by Azenta Life Sciences ...
-
bioRxiv - Cancer Biology 2022Quote: ... After PCR purification (AMPure XP SPRI beads; Beckman Coulter), we performed Gibson assembly (NEB ...
-
bioRxiv - Genetics 2022Quote: ... PCR purification was performed using AMPure XP (Beckman Coulter). Purified PCR products were pooled in equimolar concentration ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were purified using AMPure XP (Beckman Coulter) and the SPRIselect reagent (Beckman Coulter ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified using AmpureXP beads (Beckman Coulter) at a ratio of 0.7:1 beads ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were purified using SPRIselect beads (Beckman Coulter), with a 0.6:1 μl ratio of beads to PCR product (to allow for size exclusion of residual primers ...
-
bioRxiv - Genomics 2021Quote: ... by PCR and purified with AMPure beads (Beckman Coulter). Resulting ATAC libraries were sequenced with paired-end reads.
-
bioRxiv - Molecular Biology 2023Quote: ... PCR amplicons were purified using AMPure XP beads (Beckman) and Sanger-sequenced using one of the two PCR primers (Microsynth) ...
-
bioRxiv - Immunology 2022Quote: ... PCR products were purified by AMpure XP beads (Beckman). Purified DNA was further amplified by PCR using Kapa Hifi Hotstart Ready Mix with Nextra XT Index Primers from Nextra XT Index Kit (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... PCR product was purified using AMPureXP beads (A63880, Beckman). Nested PCR was performed on the purified PCR amplicon with the following cycling conditions ...
-
bioRxiv - Physiology 2023Quote: ... PCR products were purified using AMPure XP Beads (Beckman Coulter Genomics ...
-
bioRxiv - Genomics 2023Quote: ... PCR products were purified using AMPure XP (Beckman Coulter) according to protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR products were purified using AMPure XPbeads (Beckman Coulter) and eluted in 15 μl of sterile water ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR products were purified using Ampure beads (Beckman, A63881) and sequenced at the Indiana University Center for Genomics and Bioinformatics using NextSeq 500 ...