Labshake search
Citations for Beckman :
101 - 150 of 1180 citations for rno mir 101a Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... CE/MS detection was applied with the coupling of PA800 plus CE system (Beckman Coulter, Brea, CA, USA) and mass spectrometry (TRIPLE QUAD 5500 ...
-
bioRxiv - Immunology 2022Quote: ... GEM-RT products were subsequently amplified using human BCR primers and cleaned up through SPRIselect beads (Beckman Coulter). Next ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were washed 3 times and analyzed with MoFlo (Beckman, Brea, CA, USA) and associated software ...
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR product was purified by Agencourt Ampure XP PCR Purification beads per the manufacturer’s protocol (Beckman Coulter, Brea, CA). One microgram of Cas9 plasmid and 0.3 μg of each gRNA gBlock (pair ...
-
bioRxiv - Cell Biology 2020Quote: ... After purification of the PCR product with a 1: 0.6 ratio of PCR product to AMPure XP beads (Beckman Coulter), the success of cDNA preparation was confirmed using a 2100 Bioanalyzer with High-sensitivity DNA chip (Agilent) ...
-
bioRxiv - Microbiology 2019Quote: ... including library amplification for 15 PCR cycles using custom indexed primers and post-PCR clean-up with 0.85x volume Ampure XP (Beckman Coulter). Libraries were quantified using Quant-iT PicoGreen dsDNA Assay Kit (Invitrogen ...
-
bioRxiv - Pathology 2023Quote: ... Ligated cDNAs were amplified following 15 PCR cycles and PCR products were purified using AMPure XP Beads (Beckman Coulter Genomics). Libraries were validated using a Bioanalyzer on a DNA1000 chip (Agilent ...
-
bioRxiv - Genetics 2021Quote: ... PCR products were purified using SPRIselect beads (Beckman) (bead to sample ratio 0.8) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were purified (AMPure XP system, Beckman Coulter Life Sciences ...
-
bioRxiv - Plant Biology 2022Quote: ... Purified PCR products (Beckman and Coulter AMPure XP) were used for a second PCR to ligate Illumina adapters ...
-
bioRxiv - Genetics 2023Quote: ... PCR products were purified using magnetic beads (Beckman) or a QIAquick PCR Purification Kit (Qiagen ...
-
bioRxiv - Immunology 2024Quote: ... PCR amplification was followed by SPRI (Beckman Coulter) size selection to exclude fragments larger than 1,200 bp ...
-
bioRxiv - Cancer Biology 2023Quote: ... visualized by excitation with 561nm laser and emission detection with 585/42 filter using the Cytoflex S (Beckman Coulter). MSCs cultured with DiI-labeled ALL cells without transwell were used as control ...
-
bioRxiv - Cancer Biology 2020Quote: ... The pooled and normalized PCR reactions were purified using 1.8x the PCR reaction volume of AMPure XP beads (Beckman Coulter Inc). Samples were prepared for sequencing on Illumina MiSeq using the manufacturer’s standard library preparation protocol ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR templates were purified using Agencourt AMPure XP (PCR product: AMPure XP beads = 1:0.8; Beckman Coulter, Brea, California, USA) before the second PCR ...
-
bioRxiv - Genomics 2023Quote: ... PCR amplification was then performed using the SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT) and cDNA was subsequently purified using AMPure beads (Beckman Coulter). The library was split and a further 20 or 25 PCR cycles were performed using a biotin oligonucleotide (5—PCBio-TACACGACGCTCTTCCGATCT ...
-
bioRxiv - Cancer Biology 2023Quote: ... The PCR products in the two groups were mixed and were purified using the Agencourt AMPure XP PCR purification system (Beckman Coulter).
-
bioRxiv - Molecular Biology 2024Quote: ... PCR amplification was then performed using the SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT) and cDNA was subsequently purified using AMPure beads (Beckman Coulter). The library was split and a further 20 or 25 PCR cycles were performed using a biotin oligonucleotide (5—PCBioTACACGACGCTCTTCCGATCT ...
-
bioRxiv - Microbiology 2021Quote: ... and centrifuged each time at 4000 × g for 15 min (Microfuge 20R, Beckman Coulter) followed by resuspension in PBS.
-
bioRxiv - Bioengineering 2021Quote: ... Samples were then washed three times and analyzed via flow cytometry (CytoFlex, Beckman Coulter).
-
bioRxiv - Cell Biology 2023Quote: ... then incubated for 1 hr at RT before centrifugation at 100,000 x g (23°C) in a TLA100 rotor (Beckman-Coulter). The top 50% of the supernatant was removed ...
-
bioRxiv - Genomics 2022Quote: ... PCR amplicons were cleaned with AmpureXP beads (#A63882; Beckman Coulter Life Sciences ...
-
bioRxiv - Genomics 2019Quote: ... Following PCR clean-up with Ampure (Beckman, Agencourt USA), a sequencing reaction was set up using 1.0 μl of Big dye ...
-
bioRxiv - Microbiology 2020Quote: All PCR reactions were purified using RNAClean XP (Beckman Coulter ...
-
bioRxiv - Genetics 2020Quote: ... PCR products were purified using Ampure XP (Beckman Coulter) and Sanger sequenced (Genewiz ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were cleaned using AmpureXP beads (Beckman Coulter) and sequenced on an Illumina NextSeq 500 using a custom sequencing primer ...
-
bioRxiv - Genomics 2022Quote: ... PCR products were purified using AMPure beads (Beckman Coulter) and sent for Sanger sequencing by Azenta Life Sciences ...
-
bioRxiv - Cancer Biology 2022Quote: ... After PCR purification (AMPure XP SPRI beads; Beckman Coulter), we performed Gibson assembly (NEB ...
-
bioRxiv - Genetics 2022Quote: ... PCR purification was performed using AMPure XP (Beckman Coulter). Purified PCR products were pooled in equimolar concentration ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were purified using AMPure XP (Beckman Coulter) and the SPRIselect reagent (Beckman Coulter ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified using AmpureXP beads (Beckman Coulter) at a ratio of 0.7:1 beads ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were purified using SPRIselect beads (Beckman Coulter), with a 0.6:1 μl ratio of beads to PCR product (to allow for size exclusion of residual primers ...
-
bioRxiv - Genomics 2021Quote: ... by PCR and purified with AMPure beads (Beckman Coulter). Resulting ATAC libraries were sequenced with paired-end reads.
-
bioRxiv - Molecular Biology 2023Quote: ... PCR amplicons were purified using AMPure XP beads (Beckman) and Sanger-sequenced using one of the two PCR primers (Microsynth) ...
-
bioRxiv - Immunology 2022Quote: ... PCR products were purified by AMpure XP beads (Beckman). Purified DNA was further amplified by PCR using Kapa Hifi Hotstart Ready Mix with Nextra XT Index Primers from Nextra XT Index Kit (Illumina) ...
-
bioRxiv - Physiology 2023Quote: ... PCR products were purified using AMPure XP Beads (Beckman Coulter Genomics ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR products were purified using Ampure beads (Beckman, A63881) and sequenced at the Indiana University Center for Genomics and Bioinformatics using NextSeq 500 ...
-
Identification of resistance mechanisms to small-molecule inhibition of TEAD-regulated transcriptionbioRxiv - Cancer Biology 2023Quote: ... PCR products were purified using AMPure beads (Beckman Coulter) and samples sequenced using HiSeq (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR products were purified using AMPure XPbeads (Beckman Coulter) and eluted in 15 μl of sterile water ...
-
bioRxiv - Genomics 2023Quote: ... PCR products were purified using AMPure XP (Beckman Coulter) according to protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR clean-ups were performed using AMPureXP beads (Beckman Coulter Life Sciences ...
-
bioRxiv - Genomics 2023Quote: ... PCR product was purified using AMPureXP beads (A63880, Beckman). Nested PCR was performed on the purified PCR amplicon with the following cycling conditions ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR products were purified using AmpureXP beads (Beckman A63880). The sequencing libraries were then run on a 10% TBE polyacrylamide gel and purified using the DNA Clean & Concentrator-5 kit (Zymo Research D4013).
-
bioRxiv - Genomics 2023Quote: ... PCR preamplification of cDNA was performed with IS PCR and Tn5ME-A-aHic using 2X KAPA PCR mix (Kapa Biosystem, KK2602) followed by cleanup using SPRISelect beads (Beckman Coulter, REF B23319). DNA was digested by NotI-HF (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... Sample solution containing EVs was placed at the top of the tube (at RT) and ultracentrifugation (Beckman Optima L-90K Ultracentrifuge) was performed at 40,000 RPM for 16 hours at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... 6 mL of blood was layered on top and samples were centrifuged at 930 x g for 30 minutes at room temperature (RT) with no deceleration in an Allegra X-12R centrifuge (Beckman Coulter). The neutrophil layer was collected between the Histopaque layers and diluted in 4°C PMN buffer (0.5% BSA ...
-
bioRxiv - Molecular Biology 2022Quote: ... The i7 index was added in the 2nd PCR and the PCR product was cleaned up with AMPure XP SPRI beads (Beckman Coulter, 0.9X reaction volume). Completed libraries were quantified by 4200 Tapestation System (Agilent ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were purified with AMPure XP beads (Beckman Coulter). Indexed libraries were quantified by Qubit (Invitrogen) ...
-
bioRxiv - Genetics 2021Quote: ... PCR products were purified using AMPure XP beads (Beckman Coulter) and subsequently amplified for 8 cycles using primers with sequencing adapters ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR reactions were cleaned with AMPure XP beads (Beckman Coulter), run on a 2% agarose gel and a band of 300bp approximately was cut and gel purified using QIAquick Gel Extraction Kit (QIAGEN) ...