Labshake search
Citations for Beckman :
101 - 150 of 1153 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The PCR templates were purified using Agencourt AMPure XP (PCR product: AMPure XP beads = 1:0.8; Beckman Coulter, Brea, California, USA) before the second PCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR amplification was then performed using the SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT) and cDNA was subsequently purified using AMPure beads (Beckman Coulter). The library was split and a further 20 or 25 PCR cycles were performed using a biotin oligonucleotide (5—PCBioTACACGACGCTCTTCCGATCT ...
-
bioRxiv - Cancer Biology 2023Quote: ... The PCR products in the two groups were mixed and were purified using the Agencourt AMPure XP PCR purification system (Beckman Coulter).
-
bioRxiv - Genomics 2023Quote: ... PCR amplification was then performed using the SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT) and cDNA was subsequently purified using AMPure beads (Beckman Coulter). The library was split and a further 20 or 25 PCR cycles were performed using a biotin oligonucleotide (5—PCBio-TACACGACGCTCTTCCGATCT ...
-
bioRxiv - Cancer Biology 2024Quote: ... Library preparation for sequencing was performed using a two-step amplification (junction PCR followed by sequencing-ready PCR) and cleaned using SPRIselect beads (Beckman cat. B23318). Sequencing was done with Azenta.
-
bioRxiv - Genomics 2022Quote: ... PCR amplicons were cleaned with AmpureXP beads (#A63882; Beckman Coulter Life Sciences ...
-
bioRxiv - Microbiology 2020Quote: All PCR reactions were purified using RNAClean XP (Beckman Coulter ...
-
bioRxiv - Genetics 2020Quote: ... PCR products were purified using Ampure XP (Beckman Coulter) and Sanger sequenced (Genewiz ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were cleaned using AmpureXP beads (Beckman Coulter) and sequenced on an Illumina NextSeq 500 using a custom sequencing primer ...
-
bioRxiv - Genomics 2022Quote: ... PCR products were purified using AMPure beads (Beckman Coulter) and sent for Sanger sequencing by Azenta Life Sciences ...
-
bioRxiv - Cancer Biology 2022Quote: ... After PCR purification (AMPure XP SPRI beads; Beckman Coulter), we performed Gibson assembly (NEB ...
-
bioRxiv - Genetics 2022Quote: ... PCR purification was performed using AMPure XP (Beckman Coulter). Purified PCR products were pooled in equimolar concentration ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were purified using AMPure XP (Beckman Coulter) and the SPRIselect reagent (Beckman Coulter ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified using AmpureXP beads (Beckman Coulter) at a ratio of 0.7:1 beads ...
-
bioRxiv - Genomics 2021Quote: ... by PCR and purified with AMPure beads (Beckman Coulter). Resulting ATAC libraries were sequenced with paired-end reads.
-
bioRxiv - Physiology 2023Quote: ... PCR products were purified using AMPure XP Beads (Beckman Coulter Genomics ...
-
bioRxiv - Genomics 2023Quote: ... PCR products were purified using AMPure XP (Beckman Coulter) according to protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR products were purified using AMPure XPbeads (Beckman Coulter) and eluted in 15 μl of sterile water ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR products were purified using Ampure beads (Beckman, A63881) and sequenced at the Indiana University Center for Genomics and Bioinformatics using NextSeq 500 ...
-
Identification of resistance mechanisms to small-molecule inhibition of TEAD-regulated transcriptionbioRxiv - Cancer Biology 2023Quote: ... PCR products were purified using AMPure beads (Beckman Coulter) and samples sequenced using HiSeq (Illumina) ...
-
bioRxiv - Immunology 2022Quote: ... PCR products were purified by AMpure XP beads (Beckman). Purified DNA was further amplified by PCR using Kapa Hifi Hotstart Ready Mix with Nextra XT Index Primers from Nextra XT Index Kit (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... PCR product was purified using AMPureXP beads (A63880, Beckman). Nested PCR was performed on the purified PCR amplicon with the following cycling conditions ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR products were purified using AmpureXP beads (Beckman A63880). The sequencing libraries were then run on a 10% TBE polyacrylamide gel and purified using the DNA Clean & Concentrator-5 kit (Zymo Research D4013).
-
bioRxiv - Molecular Biology 2023Quote: ... PCR amplicons were purified using AMPure XP beads (Beckman) and Sanger-sequenced using one of the two PCR primers (Microsynth) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR clean-ups were performed using AMPureXP beads (Beckman Coulter Life Sciences ...
-
bioRxiv - Genetics 2024Quote: ... followed by a PCR Purification (AMPure XP, Beckman Coulter). The second PCR (98°C for 5 min ...
-
bioRxiv - Microbiology 2024Quote: ... PCR product was purified by AMPure XP (Beckman Coulter) and further purified by gel extraction with native-PAGE in 1x TBE (6% PAGE) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PCR amplicons were purified using AMPure XP beads (Beckman) and eluted in 40 uL EB buffer (Qiagen) ...
-
bioRxiv - Immunology 2024Quote: ... PCR reactions were purified using AMPure XP beads (Beckman), following manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... During PCR clean-up using SPRIselect beads (Beckman Coulter), the amplified gRNA-containing supernatant fraction was separated from the pelleted fraction ...
-
bioRxiv - Genomics 2023Quote: ... PCR preamplification of cDNA was performed with IS PCR and Tn5ME-A-aHic using 2X KAPA PCR mix (Kapa Biosystem, KK2602) followed by cleanup using SPRISelect beads (Beckman Coulter, REF B23319). DNA was digested by NotI-HF (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... The i7 index was added in the 2nd PCR and the PCR product was cleaned up with AMPure XP SPRI beads (Beckman Coulter, 0.9X reaction volume). Completed libraries were quantified by 4200 Tapestation System (Agilent ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were purified with AMPure XP beads (Beckman Coulter). Indexed libraries were quantified by Qubit (Invitrogen) ...
-
bioRxiv - Genetics 2021Quote: ... PCR products were purified using AMPure XP beads (Beckman Coulter) and subsequently amplified for 8 cycles using primers with sequencing adapters ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR reactions were cleaned with AMPure XP beads (Beckman Coulter), run on a 2% agarose gel and a band of 300bp approximately was cut and gel purified using QIAquick Gel Extraction Kit (QIAGEN) ...
-
bioRxiv - Genomics 2020Quote: ... PCR products were cleaned using AMPure XP beads (Beckman Coulter) and manufacturer protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR products were purified using AMPURE XP beads (Beckman Coulter) using a 1.8:1 volume ratio of beads to product ...
-
bioRxiv - Genomics 2022Quote: ... The PCR products were purified with AMPure XP beads (Beckman) before being sheared ...
-
bioRxiv - Immunology 2022Quote: ... PCR products were purified using 0.6X AMPure XP beads (Beckman).
-
bioRxiv - Neuroscience 2021Quote: ... The PCR amplicon was AMPure XP bead-purified (Beckman coulter)84 with a bead:sample ratio of 0.8:1 in the first round and 1:1 in the second round ...
-
bioRxiv - Developmental Biology 2020Quote: ... PCR reactions were cleaned with AMPure XP beads (Beckman Coulter), run on a 2% agarose gel and a band of 300bp approximately was cut and gel purified using QIAquick Gel Extraction Kit (QIAGEN) ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR product was purified with Ampure XP beads (Beckman Coulter), resuspend in 20 µL water ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR products were purified with Ampure XP beads (Beckman Coultier). Successful amplification of the anticipated product size was verified by gel electrophoresis ...
-
bioRxiv - Cancer Biology 2022Quote: ... The PCR products were purified with AMPure XP (BECKMAN COULTER). The amplicons were sequenced with MiSeq (2 × 300 bp) ...
-
bioRxiv - Immunology 2020Quote: Following purification of PCR products using AMPure XP beads (Beckman), the secondary PCR was performed in order to add the full-length Illumina P5 Adaptor sequence to the end of each immunoglobin amplicon ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were size-selected with AMPure XP beads (Beckman) and subjected to quality control with ScreenTape (Agilent) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified using AMPure XR beads (Beckman Coulter) following the manufacturer’s protocol with a final elution in 40 µL nuclease free water.
-
bioRxiv - Genetics 2021Quote: ... PCR products were purified with Ampure XP beads (Beckman Coulter) and further amplified using a pair of primers containing Illumina Nextera P5 and P7 adapter sites for a total of 25 cycles ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were purified using AMPure XP beads (Beckman Coulter) and quantified using the Qubit High Sensitivity 1X dsDNA kit (Invitrogen) ...
-
bioRxiv - Systems Biology 2021Quote: ... The PCR products were purified using AmpureXP beads (Beckman Coulter). The resulting libraries were evaluated on High-Sensitivity D1000 ScreenTape using the TapeStation 4200 (Agilent Technologies) ...