Labshake search
Citations for Beckman :
51 - 100 of 138 citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Surplus PCR primers were further removed by purification using AMPure XP beads (Beckman-Coulter, Villepinte, France) and the final cDNA libraries were checked for quality and quantified using capillary electrophoresis ...
-
bioRxiv - Cell Biology 2022Quote: ... The PCR primers were removed with 1x 0.9:1 SPRI beads (Beckman Coulter, Cat no. A63880) according to manufacturer’s instructions and samples eluted in 20μl ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was amplified using PCR Primer II A and subsequently purified using Ampure XP beads (Beckman). Illumina libraries were prepared using Nextera XT DNA library preparation kits (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... Surplus PCR primers were further removed by purification using AMPure XP beads (Beckman-Coulter, Villepinte, France) and the final cDNA libraries were checked for quality and quantified using capillary electrophoresis ...
-
bioRxiv - Cell Biology 2020Quote: ... The Taqman qPCR assays were performed using Biomek FXP Automated Workstation (Beckman Coulter Life Sciences).
-
bioRxiv - Genetics 2024Quote: ... to eliminate free primers and then purified the amplified fragments using Agencourt AMPure beads (Beckman Coulter A63881).
-
bioRxiv - Immunology 2020Quote: ... and FITC-conjugated anti-human CD42a mAb purchased from Beckman Coulter (Brea ...
-
bioRxiv - Immunology 2022Quote: ... and APC-labeled anti-human CD3ε mAb (#UCHT1, Beckman Coulter), to check the purity of the populations ...
-
bioRxiv - Immunology 2023Quote: ... PECy5.5-conjugated anti-human CD117 (104D2D1) was purchased from Beckman Coulter ...
-
bioRxiv - Cell Biology 2024Quote: ... Anti-human CD62P conjugated PE antibody was obtained from Beckman Coulter (Brea ...
-
bioRxiv - Cancer Biology 2020Quote: ... Amplified DNA was purified over columns and primer dimers (<100 bp) were removed using AMPure beads (Beckman Coulter). Size distribution of the amplified DNA was analyzed using High-sensitivity Qubit dsDNA Assay Kit (ThermoFisher) ...
-
bioRxiv - Genomics 2021Quote: ... the PCR product is pooled and purified with 1x AMPure XP beads to remove primers (Beckman Coulter A63881). Pooling ratios of PCR1 products were empirically determined (Supplemental Figure 4D ...
-
bioRxiv - Genomics 2021Quote: ... the PCR product is pooled and purified with 0.8x AMPure XP beads to remove primers (Beckman Coulter A63881). Pooling ratios of PCR1 products were empirically determined (Supplemental Figure 4 ...
-
bioRxiv - Microbiology 2022Quote: ... Adapter-ligated fragments were PCR amplified using indexing primers followed by purification using Agencourt XP beads (Beckman Coulter). The library electropherograms were assessed using an Agilent Bioanalyzer 2100 and Agilent DNA 1000 kit ...
-
bioRxiv - Genomics 2024Quote: ... Target sequences were then amplified using specific primers (Table 1) and purified using AMPure beads (Beckman Coulter; A63880) at concentrations appropriate to each of the target sizes ...
-
bioRxiv - Genomics 2024Quote: ... the products of the two amplifications (one per primer set) were purified with AMPure XP beads (Beckman Coulter) at a 1:1 ratio according to the manufacturer’s recommendations and pooled at equimolar concentrations ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... the products of the two amplifications (one per primer set) were purified with AMPure XP beads (Beckman Coulter) at a 1:1 ratio according to the manufacturer’s recommendations and pooled at equimolar concentrations ...
-
bioRxiv - Cell Biology 2020Quote: ... APC-A750 anti-human CD90 (Thy-1/310, #B36121 Beckman Coulter) and Vioblue anti-human CD45 antibodies (REA747 ...
-
bioRxiv - Immunology 2023Quote: ... AlexaFluor 700 anti-human CD38 (clone LS198-4-3, Beckman Coulter), APC-Cy7 anti-human CD19 (clone SJ25C1 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PE-Texas red-labeled mouse anti-human CD45RA (Beckman Coulter, B49193), and BV421 mouse anti-human CCR7 (Biolegend ...
-
bioRxiv - Immunology 2024Quote: ... anti-human TCR constant domain (IP26A; all Beckman Coulter, Krefeld, Germany), and anti-murine TCR constant domain (FITC ...
-
bioRxiv - Neuroscience 2021Quote: ... To remove primer dimers from the samples they were further purified using AMPure beads XP (Beckman Coulter, Brea, USA) with a ratio of x0.9 of beads to samples ...
-
bioRxiv - Microbiology 2020Quote: ... Pools were size-selected to remove unused primers using Agencourt® AMPure® XP (Beckman Coulter, Brea, CA, USA) following the manufacturer’s protocol and mixed to equimolar concentrations to make one final pool ...
-
bioRxiv - Genomics 2021Quote: ... PCR was then performed using the SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT) and then cDNA purified using AMPure beads (Beckman Coulter). In order to achieve a high concentration of cDNA the input was subjected to 25 cycles of PCR amplification ...
-
bioRxiv - Developmental Biology 2023Quote: ... Double size selection to remove primer dimers and fragments exceeding 1 kb was performed using SPRIselect beads (Beckman Coulter). Another quality control was performed with High Sensitivity DNA assay using the Fragment Analyzer (Agilent) ...
-
bioRxiv - Immunology 2021Quote: ... including PE-Cy7-conjugated mouse anti-human CD45 (Beckman Coulter, CA, USA), efluor660-conjugated rat anti-human OCT3/4 (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... while human B cells were CD38+/- (Beckman Coulter #6699531; 1µl per test) and CD19 (BD #557791 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The library fragments of ∼350 bp (insert plus adaptor and PCR primer sequences) were selected and isolated with Agencourt AMPure XP beads (Beckman). Library DNA was sequenced on an Illumina HiSeq X Ten platform ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR product was purified on Qiagen MinElute columns and primers dimers were removed from the 3C library by using AMPure XP beads following the manufacturer’s protocol (Beckman Coulter). Finally ...
-
bioRxiv - Molecular Biology 2022Quote: ... Of each sample 10 μl was pooled together and a left sided size selection was applied twice on the sample pool to remove primer residuals (ration 0.76x, SPRIselect Beckman Coulter). Library concentration was measured with a Quantus fluorometer (Promega ...
-
bioRxiv - Cancer Biology 2020Quote: ... Libraries were purified twice to reduce primers and short DNA fragments with 0.6x and 1x Agencourt AMPure XP beads (Beckman Coulter), respectively ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was purified on Qiagen MinElute columns and dimers of primers were removed from the 3C library by using AMPure XP beads following the manufacturer’s protocol (Beckman Coulter). Finally ...
-
bioRxiv - Genomics 2020Quote: ... PCR was performed (7 cycles) with standard Illumina paired-end primers and the amplicons were then purified with AMPure XP beads (Beckman). The length ...
-
bioRxiv - Cancer Biology 2023Quote: ... 50-100μl of the pooled library preparation reactions was used to perform magnetic bead-based purification and elimination of any residual free primer using a 0.8X ratio SPRIselect beads (Beckman Coulter) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The PCR products of 100−1,000 bp (including adaptor and primer sequences) were purified using AMPure XP beads (Beckman Coulter) and captured on an Illumina flow cell ...
-
bioRxiv - Neuroscience 2024Quote: ... This library was then amplified using Illumina (San Diego, CA) sequencing primers (Table S17) and cleaned up using 1.8X AMPure XP beads (Beckman Coulter). The input library was sequenced on one lane of an Illumina MiSeq at the University of Chicago Genomics Facility using MiSeq Reagent Kit V3 and 75bp paired-end reads.
-
bioRxiv - Cancer Biology 2024Quote: ... Each ATAC library was amplified with Nextera primers for 16 PCR cycles and purified with Agencourt AMPure XP (Beckman Coulter) to remove excess primers ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The P2-ligated DNA was then amplified for 12 rounds of PCR using custom RAD primers (Hohenlohe et al., 2012) and cleaned with 0.8X AMPure XP beads (Beckman Coulter). The final libraries were sequenced either on an Illumina HiSeq 4000 or an Illumina NovaSeq 6000 to generate 2×150 bp reads (Table S3).
-
bioRxiv - Immunology 2022Quote: ... and anti-human CD64 antibodies (APC) using a CytoFlex S (Beckman Coulter, USA). All the antibodies were purchased from SinoBiological ...
-
bioRxiv - Developmental Biology 2021Quote: ... Libraries were size-selected for 200-600 bp and primer dimers cleaned up using Ampure XP beads (Beckman Coulter Life Sciences) and were quantified using a D1000 tape on a 4200 Tapestation (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The amplified DNA was purified using a Qiagen MinElute PCR Purification Kit and primer dimers (<100 bp) were removed using AMPure beads (Beckman Coulter). ATAC-Seq was performed with two biological repeats to ensure the robustness of the data sets ...
-
bioRxiv - Immunology 2020Quote: ... two cycles for removal of primer dimer residues were performed by adding 20µl of Agencourt AMPureXP SPRI beads (Beckman Coulter, A63881), incubation of plates for 5 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR amplification was then performed using the SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT) and cDNA was subsequently purified using AMPure beads (Beckman Coulter). The library was split and a further 20 or 25 PCR cycles were performed using a biotin oligonucleotide (5—PCBioTACACGACGCTCTTCCGATCT ...
-
bioRxiv - Genomics 2024Quote: ... c) increasing PCR cycles (15 in total) and eliminating primer dimers prior to sequencing (Agencourt AMPure XP magnetic beads, Beckman Coulter). Primary PDAC were sequenced on the NovaSeq6000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Unique dual-indexed primers were used to amplify each sample followed by purification using Agencourt AMPure XP beads (Beckman Coulter, A63881). The libraries were pooled based on lung weights to ensure even read depth and sequenced (read length 2 × 150 bp ...
-
bioRxiv - Cancer Biology 2023Quote: ... Unique dual-indexed primers were used to amplify each sample followed by purification using Agencourt AMPure XP beads (Beckman Coulter, A63881). The libraries were pooled based on lung weights to ensure even reading depth and sequenced (read length 2×150bp ...
-
bioRxiv - Cancer Biology 2023Quote: ... then subjected to PCR amplification and double-sided bead purification (to remove primer dimers and larger than 1,000 bp fragments) using the AMPure XP beads (Beckman Coulter, A63881). Library size distribution and quality was measured using the High Sensitivity DNA Kit (Agilent ...
-
bioRxiv - Genomics 2023Quote: ... PCR amplification was then performed using the SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT) and cDNA was subsequently purified using AMPure beads (Beckman Coulter). The library was split and a further 20 or 25 PCR cycles were performed using a biotin oligonucleotide (5—PCBio-TACACGACGCTCTTCCGATCT ...
-
bioRxiv - Immunology 2024Quote: ... Oligonucleotide tags were added with Illumina i5 and i7 dual indexing primers to uniquely index each sample and cleaned up using AMPure XP beads (Beckman Coulter). For library concentration measurement and quality assessment ...
-
bioRxiv - Neuroscience 2024Quote: ... the reaction was added 1 µL of 0.2µM HTO primer (5’-GTGACTGGAGTTCAGACGTGTGC*T*C) prior to PCR cycling and cleaned up using SPRISelect magnetic beads (Beckman Coulter, #B23318), 80% ethanol ...