Labshake search
Citations for Beckman :
851 - 900 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... where 1.2× volume of AMPure XP beads (Beckman Coulter A63881) were first added to the pooled PCR products and at RT for 5 min ...
-
bioRxiv - Bioengineering 2024Quote: Exosomes from each cell line were isolated from a conditioned medium based on differential ultracentrifugation (Optima™ XE-100, Beckman Coulter, USA) [57] ...
-
bioRxiv - Plant Biology 2024Quote: ... The analysis was performed using a CytoFLEX flow cytometer (Beckman Coulter, CA). Three replicates were used ...
-
bioRxiv - Plant Biology 2024Quote: ... The cDNA fragments were captured and purified using the Agencourt AMPure XP magnetic beads (Beckman Coulter, Brea, CA, USA). The blunt-ended double-stranded cDNA was adenylated at the 3’ end to prevent self-ligation and facilitate ligation to the adapters with corresponding thymine (T ...
-
bioRxiv - Immunology 2024Quote: ... Unsupervised clustering of reduced clinical data was performed by FlowSOM (hierarchical consensus clustering; 25 clusters, 5 metaclusters, 10 iterations).81 All analyses were performed using Cytobank (Beckman Coulter Inc., Brea, CA).
-
bioRxiv - Biochemistry 2024Quote: ... After centrifugation for 1 hour at 55000 rpm and at 20°C in a TLS 55 (Beckman) rotor ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were resuspended in PBS with 0.02% EDTA for cell cycle analysis using a Beckman Coulter Galios 561 analyzer (Beckman Coulter).
-
bioRxiv - Cancer Biology 2024Quote: ... GFP-positive transduced cells were selected by fluorescence-activated cell sorting (FACS) (MoFlo, Beckman Coulter). Luminescence levels yielded by cell lysates were measured using the Luciferase Assay System kit (Promega ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1x library clean-up was performed using Agencourt AMPure XP beads (Beckman Coulter, A63881). Library fragment size was assessed using Agilent Bioanalyzer 2100 with the High Sensitivity DNA analysis kit (Agilent ...
-
bioRxiv - Cancer Biology 2024Quote: ... Live CD45+ cells were isolated for scRNA-seq using an Astrios (Beckman Coulter) sorter and resuspended in PBS with 0.04% BSA at a concentration of 1000 cells/µL for single-cell RNA sequencing.
-
bioRxiv - Cancer Biology 2024Quote: ... and bead purified by AMPure XP beads (Beckman Coulter, USA). DNA was quantified by Qubit HS Assay or D1000 High Sensitivity Screen Tape (Agilent ...
-
bioRxiv - Cancer Biology 2024Quote: ... The plates were then centrifuged at 2000 rpm (931 x g) for 2h at 30°C (Allegra® X-15R Centrifuge (Beckman Coulter), rotor SX4750A) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells mixed with polybrene and lentivirus were then plated in 1 mL aliquots onto 12 well plates and centrifuged at 2000 rpm (931 x g) [Allegra® X-15R Centrifuge (Beckman Coulter), rotor SX4750A] for 2 hours at 30°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were analyzed on a CytoFLEX flow cytometer (Beckman Coulter) equipped with 405 nm ...
-
bioRxiv - Cell Biology 2024Quote: ... the cells were analyzed through flow cytometry on a CytoFLEX S flow cytometer (Beckman Coulter, Brea, CA, USA).
-
bioRxiv - Cell Biology 2024Quote: ... GFP-expressing cells were sorted using fluorescence-activated cell sorting (FACS) on a MoFlo Astrios Cell Sorter with a 488 nm laser (Beckman Coulter, Brea, USA). TMEM43 protein ablation was confirmed via Western blotting.
-
bioRxiv - Molecular Biology 2024Quote: ... Virus was then purified by centrifugation through a 20% sucrose cushion at 25,000 rpm for 2.5 hours at 4 °C in a Sw32Ti rotor (Beckman Coulter). Virus pellets were resuspended in PBS and virus genomic RNA copy number was quantified by RTqPCR as described above ...
-
bioRxiv - Cell Biology 2024Quote: ... Homogenates were transferred into ultra-clear tubes (Beckman and Coulter, # 344062) and overlaid with a step gradient of 30 % iodixanol solution and 5 % iodixanol solution to a final volume of 4 ml ...
-
bioRxiv - Cell Biology 2024Quote: ... The step gradients were centrifuged for 5 h at 132.000 x g at 4 °C (SW60 Beckman and Coulter, # 335649). Subsequently ...
-
bioRxiv - Molecular Biology 2024Quote: ... bottom layer was made by diluting OptiPrep™ solution with clarified HM or digesta sample (2.25 mL OptiPrep™ + 0.75 mL sample = 3 mL) into a 5 mL open-top thin wall ultra-clear tube (Beckman Coulter). A discontinuous gradient was made with 40% (w/v) ...
-
bioRxiv - Molecular Biology 2024Quote: Density gradient ultracentrifugation using a SW Type 55 Ti swinging bucket rotor in LM-70 ultracentrifuge (Beckman Coulter, Brea, CA, USA) was achieved using OptiPrepTM iodixanol solution (60% iodixanol ...
-
bioRxiv - Cell Biology 2024Quote: ... Population density was monitored using a Z2 Coulter Counter (Beckman Coulter).
-
bioRxiv - Cell Biology 2024Quote: ... The population density of the control and induced TbMyo21 RNAi cells was measured every 24 h over a time course of 96 h using a Z2 Coulter Counter (Beckman Coulter).
-
bioRxiv - Cell Biology 2024Quote: The cell concentration of the GFPESPro-221ES.121tet and SM cell lines was measured using a Z2 Coulter Counter (Beckman Coulter). The two cell lines were used in a 2:1 ratio to dilute the GFP signal and transferred to 50 ml Falcon tubes and pelleted by centrifugation (1,000 x g ...
-
bioRxiv - Cell Biology 2024Quote: ... 6-8 PCR reactions were pooled and purified with AMPure XP SPRI Reagent (Beckman Coulter), first at 0.6x and then at a 1x volumetric ratio ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... DNA was enriched in samples with low DNA concentration (1-60 ng/μl) using AMPureXP Beads (SPRIselect, Beckman Coulter) in a 1:1 ratio ...
-
bioRxiv - Cell Biology 2024Quote: ... The same amounts of proteins were loaded on a double sucrose cushion (20% and 30% sucrose) and centrifuged at 190,000 g for 2 h at 4 °C in an Optima L-100XP ultracentrifuge (Beckman–Coulter). Extracts were incubated with pre-washed anti-Flag beads (Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were counted using a Vi-Cell XR Cell Counter (Beckman Coulter) and 2 X106 cells were resuspended in 1 mL lentivirus with 8 μg/mL polybrene in individual wells of a 12 well plate ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were counted on day 0 using a Vi-Cell XR Cell Counter (Beckman Coulter) and plated in a tissue culture-treated 6-well plates at 20,000 cells/mL in 2 mL of complete media containing XHC-640 (100 nM) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were trypsinized 3 or 6 days later to make single cell suspensions and were counted using a Vi-Cell XR Cell Counter (Beckman Coulter). Cell counts were then normalized to the number of cells plated at day 0.
-
bioRxiv - Cell Biology 2024Quote: ... Results were analyzed using the Kaluza Analysis software (Beckman Coulter Life Sciences). Unstained and ‘fluorescence-minus-one’ samples were included in the analysis as the basis for the gating strategy (Figure S3B) ...
-
bioRxiv - Neuroscience 2024Quote: ... and centrifuged at 28,000rpm for 2h at 4 °C in a SW 41 rotor (Beckman). The virus pellet was resuspended in 60μL of PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... The total 200mL of supernatant was centrifuged at 28,000rpm for 2h at 40 °C in a 45Ti rotor (Beckman), which can sustain faster speeds ...
-
bioRxiv - Systems Biology 2024Quote: ... Acquisition was performed on a Cytoflex S or Cytoflex LX (Beckman Coulter). Data were analyzed with FlowJo (BD).
-
bioRxiv - Synthetic Biology 2024Quote: ... Double-stranded DNA was purified by solid phase reversible immobilization (SPRI) bead cleanup using AMPure XP beads (Beckman Coulter #A63881). Beads were added in 1.8:1 volume:volume ratio to PCR template and isolated per manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... The eluted sample was further purified using AMPure XP PCR purification beads (Beckman Coulter A63880) at a 1:1 sample to bead ratio ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The gradients were centrifuged at 154,300× g for 18 hours at 18°C (SW41Ti rotor, Optima XE-90 Ultracentrifuge [Beckman Coulter]). After centrifugation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The resulting amplicons were purified using a 1.2X-0.6X double-sided SPRIselect bead DNA cleanup (Beckman Coulter), prepared for sequencing using a KAPA HyperPrep kit (Roche ...
-
bioRxiv - Synthetic Biology 2024Quote: ... using a Gradient Master (Beckman Coulter). The gradients were centrifuged at 154,300× g for 18 hours at 18°C (SW41Ti rotor ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The final scCARseq library was then purified using a 1X-0.6X double-sided SPRIselect bead DNA cleanup (Beckman Coulter) and sequenced with the Illumina platform using the same cycle scheme as the scRNAseq and scCITEseq libraries ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Following a 0.6X SPRIselect bead DNA cleanup (Beckman Coulter) the DNA product was used as a template for a second PCR reaction using primer mix F2 and R2 (Supp ...
-
bioRxiv - Systems Biology 2024Quote: ... The liquid handler Biomek FX (Beckman Coulter) was used to prepare plates ...
-
bioRxiv - Systems Biology 2024Quote: ... After cleanup with AMPure XP Reagent (Beckman Coulter, 1:1 ratio beads:PCR), iPCR amplification was carried out with KAPA HiFi HotStart ReadyMix (Roche) ...
-
bioRxiv - Systems Biology 2024Quote: ... amplified libraries were size selected for a range of 400-800 bp using SPRIselect beads (Beckman Coulter). NGS was performed on an Illumina NextSeq550 or llumina HiSeq 2500 sequencer according to the manufacturers’ protocols with custom first-read primer (1:1 mix of GAGTGATTGACTACCCGTCAGCGGGGGTCTTTCA and TGAGTGATTGACTACCCACGACGGGGGTCTTTCA).
-
bioRxiv - Systems Biology 2024Quote: The CZE-MS/MS system configuration involved the integration of a CESI 8000 Plus CE system (Beckman Coulter) with an Orbitrap Exploris 480 mass spectrometer (Thermo Fisher Scientific) ...
-
bioRxiv - Systems Biology 2024Quote: ... the stained samples were subjected to visualisation using a CytoFlex S Flow Cytometer (Beckman Coulter). During the visualisation process ...
-
bioRxiv - Molecular Biology 2024Quote: ... The RNA was purified with RNAClean XP beads (Beckman Coulter).
-
bioRxiv - Synthetic Biology 2024Quote: ... Following a 1X SPRIselect bead DNA cleanup (Beckman Coulter), the DNA product containing partial Illumina-specific adaptors was further amplified and indexed using Dual Index Kit TT ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 200 μL of supernatant was loaded onto sucrose gradients (10–50% sucrose in 0.6 M KP buffer) prepared in tubes (14 × 89 mm, Open-Top Thinwall Ultraclear tubes [Beckman Coulter, CA, USA]) using a Gradient Master (Beckman Coulter) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Cells were then filtered through a 40 μm cell strainer and analyzed using a CytoFLEX S instrument (Beckman Coulter). We used the self-build python code to analyze the flow data.