Labshake search
Citations for Stemcell Technologies :
1 - 50 of 1545 citations for Rat Small Nuclear Ribonucleoprotein U5 Subunit 200 SNRNP200 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Human fetal tissue derived U5 NCSs were cultured in NeuroCult NS-A basal medium (Stem Cell Technologies) supplemented with N2 (made in-house 2x stock in Advanced DMEM/F-12 (Thermo Fisher Scientific)) ...
-
bioRxiv - Cell Biology 2023Quote: CRISPR/Cas9 editing was performed with the ArciTect ribonucleoprotein (RNP) system (STEMCELL Technologies). The designed sgRNA targeted exon 2 of the NF2 gene (GTACACAATCAAGGACACAG ...
-
bioRxiv - Microbiology 2021Quote: ... IFNα was quantified using the pan-IFNα ELISA kit (Stem Cell Technologies). IFNβ was quantified using human IFN-beta Quantikine ELISA kit (R&D Systems) ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with NeuroCult proliferation kit (mouse & rat, STEMCELL Technologies, #05702), human recombinant EGF (20 ng/mL ...
-
bioRxiv - Cancer Biology 2024Quote: ... in NeuroCult Mouse/Rat Proliferation Kit medium (STEMCELL Technologies #05702) with 1x Pen/Strep ...
-
bioRxiv - Cell Biology 2021Quote: ... and small-molecule Thiazovivin (5μM) (STEMCELL Technologies) applied to the medium before single-cell passaging ...
-
bioRxiv - Cancer Biology 2024Quote: Serum IFNγ protein was measured using the mouse IFNγ ELISA kit (StemCell Technologies 02020), following the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2023Quote: ... as small aggregates using ReLeSR (STEMCELL Technologies, 05872). Karyotyping for H1 and H9 cells was as described above for the CRTD1 iPS cell line and cells were routinely tested for mycoplasma contamination by PCR as published previously (Young et al. ...
-
bioRxiv - Developmental Biology 2024Quote: ... as small aggregates using ReLeSR (STEMCELL Technologies, 05872). Cells from the parental cell line and the derived reporter lines used for the experiments here were analyzed for chromosomal abnormalities using standard G banding karyotyping ...
-
bioRxiv - Neuroscience 2024Quote: ... detached as small aggregates using mFReezer (STEMCELL Technologies, #05854), and frozen at −80°C ...
-
bioRxiv - Genetics 2021Quote: Add normal rat serum from the EasySep Mouse T-cell Isolation Kit (StemCell Technologies) and Isolation Cocktail ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were dissociated into small aggregates using ReLeSR (STEMCELL technologies) every 5-7 days and split into freshly coated Matrigel culture dishes.
-
bioRxiv - Neuroscience 2023Quote: ... Cells were dissociated into small aggregates with ReLeSR (StemCell Technologies) every 5-7 days and split in a 1:5 ratio into fresh Matrigel-coated dishes ...
-
bioRxiv - Physiology 2021Quote: The EPO concentrations from 34 serum samples were determined using the Human Erythropoietin ELISA Kit from Stemcell Technologies. Briefly ...
-
bioRxiv - Immunology 2021Quote: ... and rat serum (Stemcell Technologies), followed by the anti-phosphoSTAT3 (Tyr705 ...
-
bioRxiv - Immunology 2022Quote: ... samples were cryopreserved in as small fragments in CryoStor CS10 (Stem Cell Technologies #07959). Synovial tissue quality and grading of synovitis32 were evaluated by histologic analysis (H&E).
-
bioRxiv - Cancer Biology 2021Quote: ... Nodules were then cut into small pieces and digested with Collagenase/Hyaluronidase (StemCell Technologies) and DNase I (StemCell Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were passaged by dissociation into small aggregates with ReLeSR (StemCell Technologies, Vancouver, Canada) every 5–7 days and split in a 1:5 ratio into fresh Matrigel-coated dishes ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse small intestinal crypts were isolated by applying Gentle Cell Dissociation Reagent from STEMCELL technologies at room temperature for 20 min ...
-
bioRxiv - Immunology 2023Quote: ... human CD4+ T cells were purified from frozen peripheral blood mono-nuclear cells (PBMCs) (STEMCELL Technologies) with EasySep Human CD4+ T Cell Isolation Kit (STEMCELL Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... and/or Normal Rat Serum (STEMCELL Technologies: 13551). Flow cytometry was performed on LSR Fortessa (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... and/or rat serum (2%; Stem Cell Technologies) for 5min on ice prior to adding fluorescent antibodies (BioLegend ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µl of 2% rat serum (Stemcell technologies) was added to each well for 15 minutes at room temperature and proceeded to further staining without a washing step.
-
bioRxiv - Neuroscience 2023Quote: ... the natural developmental signaling factors were recapitulated with small molecules including Ascorbic acid (72132, StemCell technologies), CHIR99021 (72054 ...
-
bioRxiv - Microbiology 2024Quote: ... containing 0.1% penicillin/streptomycin and propagated as small aggregates using accutase or ReLeSR (Stem Cell Technologies). All iPSC colonies were cultured at 37°C in a 5% CO2 incubator on 6-well tissue culture plates coated with matrigel (Corning ...
-
bioRxiv - Developmental Biology 2024Quote: ... The hPSCs were routinely passaged in small colonies by Gentle Cell Dissociation Reagent (STEMCELL Technologies, 07174) at a 1:8 split ratio every 4-5 days ...
-
bioRxiv - Immunology 2020Quote: Intestinal crypts were dissociated from mouse small intestine using Gentle Cell Dissociation Reagent (Stemcell Technologies, Cambridge, UK). The crypts were then re-suspended in Intesticult medium (Stemcell Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... iPSCs were either single-cell sorted or seeded as small aggregates in mTeSR Plus (Stem Cell Technologies). Subsequently ...
-
bioRxiv - Cancer Biology 2023Quote: ... The corpus was cut into small pieces and incubated with Gentle Cell Dissociation Reagent (STEM Cell Technology) for 10 min ...
-
bioRxiv - Immunology 2022Quote: ... erythrocytes were removed by treating with ACK buffer for 3 min on ice and CD4+ T cells were enriched using the EasySep™ Rat CD4+ T Cell Isolation Kit (StemCell technologies, 19642), before purification by sorting ...
-
bioRxiv - Developmental Biology 2024Quote: ... the tissues were dissociated into single cell suspension using NeuroCult enzymatic dissociation kit for adult mouse and rat CNS tissue (Stem Cell Technologies 05715) and plated on ultra-low attachment 6-well plates (Corning 3471 ...
-
bioRxiv - Cell Biology 2022Quote: ... large and small airway cells will be separately cultured in PneumaCult™-Ex Plus Medium (05040, STEMCELL Technologies) and maintained at 37°C with 5% CO2 ...
-
bioRxiv - Neuroscience 2021Quote: ... the media with small molecules was transitioned to mTeSR1 full stem cell maintenance media (Stemcell Technologies Cat#85850) with the media being changed daily ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were passaged in small aggregates (1:7/1:10 depending on the line) using ReLeSR (StemCell Technologies). 10 μM Y-27632 (ROCK inhibitor ...
-
bioRxiv - Cell Biology 2024Quote: ... minced into small pieces and collected in dissociation media containing Epicult-B Basal medium (Stem Cell Technologies, 05610) supplemented with Epicult B supplement ...
-
bioRxiv - Systems Biology 2024Quote: ... Mouse and Rat proliferation supplement 10% (Stem Cell Technologies #05701), Recombinant Human FGF (20 ng/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... Low-density (1.077g/cc) mono-nuclear cells were obtained from AML BM using Ficoll density gradient centrifugation (Stem cell technologies).
-
bioRxiv - Immunology 2020Quote: ... Tumors were cut into small pieces with a razor blade and incubated with collagenase IV (STEMCELL Technologies, Kent, WA) on a rotator at 37°C for 1 hour ...
-
bioRxiv - Neuroscience 2021Quote: ... 200 nM ascorbic acid (StemCell Technologies), 1x penicillin streptomycin (ThermoFisher ...
-
bioRxiv - Pathology 2022Quote: ... 200 µM Ascorbic Acid (StemCell Technologies), and 1µM Dibutyryl-cAMP (StemCell Technologies).
-
bioRxiv - Bioengineering 2023Quote: ... and broken down to small fragments by a 200uL pipet tip rinsed with Anti-Adherence Rinsing Solution (07010, STEMCELL Technologies). The tissue fragment suspension was transferred into an Anti-Adherence Rinsing Solution coated 15mL conical tube on ice and allowed to sediment by gravity for at least 5 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... iPSCs were dissociated into small aggregates and transferred to untreated tissue culture flasks with SMAD inhibitors SB431542 (Stemcell Tech, 72234) and DMH1 (Tocris ...
-
bioRxiv - Bioengineering 2022Quote: ... via Ficoll-Paque (Cytavia) gradient selection for peripheral blood mono-nuclear cells followed by human CD8+ T cell negative magnetic selection (Stem Cell Technologies). Primary CD8+ T cells were thawed in supplemented RPMI 1640 2-12 hours prior to the start of experiments.
-
bioRxiv - Neuroscience 2020Quote: ... The iPSCs were subjected to monolayer Dual SMAD inhibition by changing the media to Neural Induction Media (NIM) which is composed of NBM supplemented with small molecules SB431542 (10μM, an inhibitor of TGFβ pathway) (72232, Stem Cell Technologies) and LDN193189 (0.1μM ...
-
bioRxiv - Neuroscience 2024Quote: ... media was removed and neural induction media (NIM; Supplementary Table 2) supplemented with small molecules 10 µM SB431542 (StemCell Technologies, #72146) and 0.1 µM LDN193189 (StemCell Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were split by dissociating to small clusters and replating at a 1:3-1:4 ratio using ReLeSR (StemCell Technologies) once cell clusters reached ∼70% coverage of the culture surface ...
-
bioRxiv - Developmental Biology 2023Quote: ... Organoids were cut into small pieces using a scalpel and thoroughly washed with HBSS buffer without Ca2+/Mg2+ (StemCell Technologies, #37250) to remove debris.
-
bioRxiv - Molecular Biology 2024Quote: ... NIM is composed of NBM supplemented with small molecules SB431542 (10 µM, an inhibitor of TGFβ pathway) (72232, Stem Cell Technologies) and LDN193189 (0.1 µM ...
-
Pluripotent stem cell SOX9 and INS reporters facilitate differentiation into insulin-producing cellsbioRxiv - Developmental Biology 2021Quote: ... 200 ng/ml EGF (Stem Cell Technologies), 0.5 µM LDN193189 ...
-
bioRxiv - Neuroscience 2021Quote: ... ascorbic acid (200 μM, #72132; StemCell Technologies), GDNF (20 ng/ml ...