Labshake search
Citations for Stemcell Technologies :
1 - 50 of 2377 citations for Human H ACA Ribonucleoprotein Complex Subunit 1 GAR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: The EPO concentrations from 34 serum samples were determined using the Human Erythropoietin ELISA Kit from Stemcell Technologies. Briefly ...
-
bioRxiv - Cell Biology 2024Quote: ... Isolation was performed within 1 h after the blood draw using the Easy sep human neutrophil negative isolation kit (STEMcell Technologies, Vancouver, Canada) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: CRISPR/Cas9 editing was performed with the ArciTect ribonucleoprotein (RNP) system (STEMCELL Technologies). The designed sgRNA targeted exon 2 of the NF2 gene (GTACACAATCAAGGACACAG ...
-
bioRxiv - Microbiology 2021Quote: ... 1 × 105 human NK cells isolated from PBMC using EasySep human NK cell isolation kit (Stem Cell Technologies) were added to wells in the presence of CD107a PE (BD ...
-
bioRxiv - Microbiology 2023Quote: ... Human NK cell or Human Monocyte CD14+ Isolation kits (STEMCELL Technologies), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... plated cells were immediately supplemented with ImmunoCult™ human CD3/CD28/CD2 T cell activator tetrameric antibody complex (Stemcell Technologies cat. 10970) at 20μl/ml ...
-
bioRxiv - Microbiology 2021Quote: ... IFNα was quantified using the pan-IFNα ELISA kit (Stem Cell Technologies). IFNβ was quantified using human IFN-beta Quantikine ELISA kit (R&D Systems) ...
-
bioRxiv - Immunology 2020Quote: ... EasySep human CD4+ T cell enrichment kit and EasySep human CD8+ T cell enrichment kit (STEMCELL Technologies, Canada), respectively ...
-
bioRxiv - Neuroscience 2023Quote: Flow cytometric analysis was performed on healthy control PBMCs after 48h stimulation with ImmunoCult™ human CD3/CD28/CD2 T cell activator tetrameric antibody complex (Stemcell Technologies cat. 10970) at 20μl/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... CellSep Human CD19+ selection kit (Stem Cell Technologies) was used to enrich for CD19+ cells ...
-
bioRxiv - Immunology 2023Quote: ... EasySep Human CD34+ Positive Selection Kit (Stemcell Technologies) was used to enrich for CD34+ cells to >90% purity.
-
bioRxiv - Immunology 2023Quote: ... and EasySep Human Monocyte Isolation Kit (StemCell Technologies). In the coculture experiment ...
-
bioRxiv - Cancer Biology 2022Quote: ... human leukemia cells were isolated using EasySepTM Mouse/Human Chimera Isolation Kit (#19849; Stemcell Technologies). All animal experiments were approved by and performed in accordance with guidelines of the Institutional Animal Care and Use Committee at University of Colorado (protocol No ...
-
bioRxiv - Cell Biology 2020Quote: . Primary human CD3+ and CD8+ T cells were isolated from unfractionated PBMCs using the EasySep Human T cell Isolation Kit and Human CD8 T cell isolation kit with RapidSpheres (Stemcell Technologies). Mobilized human primary CD34+ cells from Peripheral Blood (were obtained from Caltag Medsystems ...
-
bioRxiv - Bioengineering 2020Quote: ... CD4pos and CD8pos T cells were isolated by negative selection using EasySep Human CD4+ T Cell Isolation Kit and EasySep Human CD8+ T Cell Isolation Kit (STEMCELL Technologies), respectively ...
-
bioRxiv - Immunology 2022Quote: CD4+ T cells and CD25hi CD4+ T cells were negatively isolated from PBMCs separately by using Easysep human CD4+ T cell isolation kits and EasySep Human CD4+CD127lowCD25+ Regulatory T Cell Isolation Kit (STEMCELL Technologies), respectively ...
-
bioRxiv - Immunology 2024Quote: ... CD4+ T cells and CD8+ T cells were enriched using the EasySep Human CD4+ T Cell Isolation Kit and EasySep Human CD8+ T Cell Isolation Kit (STEMCELL Technologies), respectively ...
-
bioRxiv - Immunology 2021Quote: ... human neutrophils were purified from blood using the EasySep™ Human Neutrophil Enrichment Kit (STEMCELL Technologies), according to manufacturer’s protocol.
-
bioRxiv - Cell Biology 2020Quote: Human Monocyte were acquired from frozen PBMCs with STEMCELL EasySep Human Monocyte Enrichment kit (STEMCELL TECHNOLOGIES). Purified monocytes were cultured in RPMI-1640 Glutamax medium (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: Human pDC isolation was performed using an EasySep™ Human Plasmacytoid DC Enrichment kit (STEMCELL Technologies) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2020Quote: ... and the EasySep human monocyte isolation kit (StemCell Technologies) with equivalent results ...
-
bioRxiv - Biochemistry 2022Quote: ... with EasySep Human T cell Isolation Kit (STEMCELL Technologies). Cells were then activated for 3 days in “Complete media” (Immunocult-XF T cell expansion media (STEMCELL Technologies) ...
-
bioRxiv - Immunology 2024Quote: ... or Human T Cell Enrichment Kits (Stem Cell Technologies) and cultured in RPMI 1640 (ATCC ...
-
bioRxiv - Biochemistry 2024Quote: Human CD4+CCR6+CXCR3- T cells were isolated from human donor leukopaks using EasySep™ Human Th17 Cell Enrichment Kit (StemCell Technologies, 18162). To obtain large quantities of cells ...
-
bioRxiv - Bioengineering 2021Quote: ... CD3+ T cells or CD56+CD3-NK cells were isolated from the PBMC population using the EasySep Human T Cell Isolation Kit or EasySep Human NK Cell Isolation Kit (STEMCELL Technologies, Cambridge, MA). T cells were frozen at 1-2 × 107 cells/mL and NK cells were frozen at 5 × 106 cells/mL in CryoStor CS10 (STEMCELL Technologies ...
-
bioRxiv - Immunology 2022Quote: ... CD8+ and CD3+ T cells were isolated from PBMCs using the EasySep™ Human CD8+ T Cell Isolation Kit and EasySep™ Human T Cell Isolation Kit (both from STEMCELL Technologies), respectively ...
-
bioRxiv - Immunology 2022Quote: B cells were enriched from human PBMCs using EasySep Human Pan-B Cell Enrichment Kit (StemCell Technologies) before being incubated with Fc block (BD Biosciences ...
-
bioRxiv - Immunology 2019Quote: ... Human CD45+ cells were enriched using the EasySep™ Mouse/Human Chimera Isolation Kit (Stemcell technologies, 19849) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Primary human T cells were isolated using the RosetteSep Human T cell Enrichment kit (Stem Cell Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: Human CD14+ monocytes were isolated from leukopaks using the EasySep Human CD14+ Positive Selection Kit (STEMCELL Technologies) and differentiated into monocyte-derived dendritic cells (moDCs ...
-
bioRxiv - Synthetic Biology 2022Quote: Primary CD4+ and CD8+ T cells were isolated from blood of anonymous donors by negative selection using the Human CD4+ T cell isolation kit and Human CD8+ T cell isolation kit (STEMCELL Technologies #17952 and #17953). T cells were cryopreserved in RPMI1640 (UCSF cell culture core ...
-
bioRxiv - Microbiology 2022Quote: ... EasySep™ Human CD14 Positive Selection Kit II (StemCell Technologies) was used ...
-
bioRxiv - Immunology 2020Quote: EasySep™ Direct Human NK cell Isolation Kit (StemCell Technologies);
-
bioRxiv - Neuroscience 2022Quote: ... EasySep Negative Selection Human Monocyte Enrichment kits (Stemcell Tech, Inc.), without CD16 depletion ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented NeuroCult NS-A proliferation kit (human, STEMCELL Technologies, #05751), human recombinant EGF (20 ng/mL ...
-
bioRxiv - Immunology 2023Quote: ... with EasySep Human CD4+ T Cell Isolation Kit (STEMCELL Technologies). Enriched CD4+ cells were stained for 30 min on ice with antibodies against anti-CD4 ...
-
Chimeric Antigen Cytotoxic Receptors for In-Vivo Engineering of Tumor-targeting Natural Killer CellsbioRxiv - Immunology 2023Quote: ... EasySep™ Human NK cell-negative isolation kit (StemCell Technologies) was used to isolate human peripheral blood NK cells from healthy donor leukopaks ...
-
Chimeric Antigen Cytotoxic Receptors for In-Vivo Engineering of Tumor-targeting Natural Killer CellsbioRxiv - Immunology 2023Quote: ... EasySep™ Human T-cell-negative isolation kit (StemCell Technologies) was used to isolate peripheral blood T cells from healthy donor leukopaks ...
-
bioRxiv - Immunology 2024Quote: ... using EasySep™ Human NK Cell Isolation Kit (Stemcell Technologies). The isolated NK cells were incubated overnight at 37°C 5% CO2 in R10 (RPMI-1640 (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... human neutrophils were isolated from whole blood using the EasySep Direct Human Neutrophil Isolation kit from Stemcell Technologies by immunomagnetic negative selection ...
-
bioRxiv - Cancer Biology 2022Quote: CD8+ cells were enriched from human PBMCs with EasySep Human CD8+ T Cell Isolation Kit (Stem Cell Technologies) and stimulated with 5 ug/mL Ultra-LEAF anti-human CD3 (Biolegend ...
-
bioRxiv - Cell Biology 2024Quote: ... Human CD34+ cells were magnetically enriched with the EasySep™ Human CD34 Positive Selection Kit II (STEMCELL Technologies) from either normal BM or CB samples ...
-
bioRxiv - Immunology 2022Quote: ... CD4+ Human T cells were enriched from PBMCs using EasySep™ Human CD4+ T Cell Isolation Kit (StemCell Technologies) according to the manufacturers protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... A crude enrichment for human cells was performed using an EasySep™ Mouse/Human Chimera Isolation Kit (STEMCELL Technologies) as per manufacturer instructions but with only a single separation on the magnet and with an extra wash of the mouse cells retained on the magnet during the pour off ...
-
bioRxiv - Cell Biology 2019Quote: ... Human neutrophils were isolated within 1h after drawn using the human neutrophil direct isolation kit (STEMcell Technologies, Vancouver, Canada) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: Human B cells were enriched from cryopreserved PBMCs using the EasySep™ Human B Cell Enrichment Kit (STEMCELL Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Primary human B cells were isolated from PBMCs using the EasySep Human Naïve B cell isolation kit (Stemcell Technologies). Naïve B cells were cultured with or without VC (100 µg/mL ...
-
bioRxiv - Cancer Biology 2021Quote: EasySep human CD45 Depletion kit II (Stem Cell Technology, Cat#: 17898) was used to extract immune cells from freshly dissected patient tumors ...
-
bioRxiv - Bioengineering 2021Quote: ... using EasySep™ human T cell isolation kit (#17951, StemCell Technologies). 10,000 Raji cells were mixed with 100,000 T cells in media containing different concentrations of purified BiTE clones (Clone 5 and Clone 6) ...
-
bioRxiv - Cancer Biology 2021Quote: ... EasySep™ Human Epcam positive selection kit (Stemcell Technologies, Cat# 17846) was used on the single cell suspension for Epcam positive OC epithelial cell selection following manufacturer instructions.