Labshake search
Citations for Stemcell Technologies :
3401 - 3450 of 8825 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... referred to as stem cell medium (SCM, #05041, Stemcell Technologies, Vancouver, Canada) supplemented as described [11] ...
-
bioRxiv - Bioengineering 2023Quote: ... we single cell sorted ATTO550 positive cells for monoclonal expansion in 96-well plates containing their corresponding dTMP-supplemented culture media (hiPSC additionally supplemented with 10% Clone R (StemCell Technologies)) ...
-
bioRxiv - Neuroscience 2023Quote: ... CHIR99021 (72054, StemCell Technologies), DMH-1 (73634 ...
-
bioRxiv - Neuroscience 2023Quote: ... and treated with 1mL ReLeSR (05872, StemCell Technologies) at room temperature for one minute ...
-
bioRxiv - Neuroscience 2023Quote: ... the natural developmental signaling factors were recapitulated with small molecules including Ascorbic acid (72132, StemCell technologies), CHIR99021 (72054 ...
-
bioRxiv - Neuroscience 2023Quote: ... ROCK inhibitor (Y-27632, 72304, StemCell technologies), and Compound E (73952 ...
-
bioRxiv - Neuroscience 2023Quote: ... in mTESR1 medium (Stem Cell Technologies). Passaging was performed using Gentle cell dissociation reagent (Stem Cell Technologies).
-
bioRxiv - Neuroscience 2023Quote: ... in embryoid body (EB) Seeding medium with 50 μM ROCK inhibitor (Y27632, Stem Cell Technologies). On day 7 EBs were transferred from AggrewellTM800 24-well plates using wide-bore p1000 pipette tips and embedded in Matrigel by gently mixing around 30 EBs in 100 μl Expansion medium with 150 μl cold Matrigel (Corning ...
-
bioRxiv - Neuroscience 2023Quote: ... pre-treated with Anti-Adherence Rinsing Solution (Stem Cell Technologies) in embryoid body (EB ...
-
bioRxiv - Neuroscience 2023Quote: Guided FOs were generated using the STEMdiff Dorsal FO Differentiation Kit (Stem Cell Technologies) and maintained with the STEMdiff Neural Organoid Maintenance Kit (Stem Cell Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... they were treated with 10mM ROCK inhibitor (72304, StemCell Technologies) for 24 hours following the passage ...
-
bioRxiv - Neuroscience 2023Quote: ... 600,000 iPSCs per well were seeded in AggrewellTM800 24-well plates (Stem Cell Technologies) pre-treated with Anti-Adherence Rinsing Solution (Stem Cell Technologies ...
-
bioRxiv - Neuroscience 2023Quote: Unguided FOs were generated with the Cerebral Organoid Kit (Stem Cell Technologies) according to manufacturer instructions with the following modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... Passaging was performed using Gentle cell dissociation reagent (Stem Cell Technologies).
-
bioRxiv - Neuroscience 2023Quote: ... 10% Iodixanol solution (10% Iodixanol (OptiPrep™, cat#: 7820, STEMCELL Technologies, Vancouver, BC, Canada), 25 mM KCl (cat# ...
-
bioRxiv - Microbiology 2023Quote: ... Ruxolitinib (STEMCELL Technologies) Vorinostat/SAHA (Abcam) ...
-
bioRxiv - Neuroscience 2023Quote: GNAO1+/G203R#2 hiPSCs were cultured in mTeSR™1 medium (Stem Cell Technologies) on Matrigel (Corning)-coated plates following the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2023Quote: ... 250 cells per well were plated in Methocult Optimum media in SmartDish plates (both StemCell Technologies). Plates were incubated in a secondary enclosure at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: Cerebral organoids were derived from hiPSC using the STEMdiff™ Cerebral Organoid Kit (StemCell Technologies, #08570, #08571) following the manufactureŕs instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Flow through was adjusted to a final Iodixanol concentration of 25% and layered on top of a gradient with 29% Iodixanol (Stemcell Technologies). After spinning the samples for 20 minutes at 13500x g the supernatant was carefully removed without disrupting the remaining purified nuclei pellet ...
-
bioRxiv - Cell Biology 2023Quote: CRISPR/Cas9 editing was performed with the ArciTect ribonucleoprotein (RNP) system (STEMCELL Technologies). The designed sgRNA targeted exon 2 of the NF2 gene (GTACACAATCAAGGACACAG ...
-
bioRxiv - Cell Biology 2023Quote: iPSCs were grown on growth factor-reduced Matrigel (BD Biosciences)-coated 6-well plates and cultured in mTESR Plus medium (STEMCELL Technologies). iPSCs were split using Accutase (Merk ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were further en-riched with positive CD90.2 selection (Stemcell Technologies, Catalog # 18951), washed ...
-
bioRxiv - Neuroscience 2023Quote: ... A crude live cell mixture was obtained by filtration and negative selection using Easy Eights EasySep Magnet and Dead Cell Removal kit (Stemcell Technologies, Catalog # 17899). Cells were further en-riched with positive CD90.2 selection (Stemcell Technologies ...
-
bioRxiv - Immunology 2023Quote: ... Peripheral blood mononuclear cells (PBMCs) were isolated by density-gradient centrifugation using Lymphoprep (STEMCELL Technologies). Cell viability was assessed using 0.4% Trypan Blue solution (Gibco) ...
-
bioRxiv - Microbiology 2023Quote: ... All reagents used for nasal ALI culture growth and differentiation were acquired from Stemcell Technologies. Nasal ALI cultures were grown and differentiated at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... Primary human small airway epithelial cells (HSAEC, ATCC, PCS-301-010) were purchased from ATCC and maintained in PneumaCult™-Ex Plus Medium (STEMCELL Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: CD4+ T cells were isolated from pooled splenic cell suspensions by magnetic negative selection using EasySep™ Mouse CD4+ T Cell Isolation Kit (StemCell Technologies) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... B cells were then isolated using a human B cells enrichment kit (Stemcell Technologies, Cat#19054). Briefly ...
-
bioRxiv - Immunology 2023Quote: ILC were isolated from PBMCs by negative selection using the EasySep™ Human Pan-ILC Enrichment Kit according to manufacturer’s instructions (Stemcell Technologies). ILC were sorted using FACSARIA™IIu (BD Biosciences ...
-
bioRxiv - Microbiology 2023Quote: Human peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats from anonymized healthy blood donors by Ficoll density centrifugation using Lymphoprep (Stemcell Technologies). Buffy coats were provided by the Blood Donation Service Zurich ...
-
bioRxiv - Immunology 2023Quote: ... PBMC were isolated from blood collected in ethylenediaminetetraacetic acid-anticoagulated (EDTA) tubes by lymphocyte separation medium density gradients (Stemcell technologies, cat# 07801) and resuspended in PRMI 1640 medium supplemented with 10% FCS ...
-
bioRxiv - Neuroscience 2023Quote: HD patient iPSCs (ND50036) were obtained from NINDS and maintained in mTeSR Plus (STEMCELL Technologies; 100-0276) medium on Matrigel (Corning ...
-
bioRxiv - Microbiology 2023Quote: Dorsal forebrain regionalized neural organoids (RNOs) were generated using the STEMDiff™ Dorsal Forebrain Organoid Differentiation Kit (STEMCELL Technologies™) and STEMDiff™ Neural Organoid Maintenance Kit (STEMCELL Technologies™ ...
-
bioRxiv - Microbiology 2023Quote: ... dissociation of hiPSCs and seeding 3.6 x106 cells/well in AggreWell™800 plates (STEMCELL Technologies™). Medium was refreshed daily by removing and adding 1.5 mL basal medium ...
-
bioRxiv - Microbiology 2023Quote: ... After two passages in cell proliferation media (PneumaCult-Ex Plus medium, STEMCELL Technologies) supplemented with antibiotics ...
-
bioRxiv - Microbiology 2023Quote: ... media were replaced with PneumaCult-ALI-S medium (STEMCELL Technologies) in the basal chamber ...
-
bioRxiv - Microbiology 2023Quote: ... 22 µL of magnetic beads were next added (Stemcell technologies, EasySep APC Positive Selection Kit II ...
-
bioRxiv - Microbiology 2023Quote: The remaining 180 µL was stained with 20 µL of anti-APC beads (Stemcell technologies, EasySep APC Positive Selection Kit II ...
-
bioRxiv - Neuroscience 2023Quote: ... EasyStep Mouse CD11b positive Selection Kit II (StemCell Technologies, 18970A), as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were fed three times a week with mTeSR1 plus medium (STEMCELL Technologies) and passaged twice a week by dissociation in 0.02% EDTA ...
-
bioRxiv - Molecular Biology 2023Quote: ... and plated in fresh mTeSR™1 media supplemented with 10 μM of Y-27632 (Stemcell Technologies).
-
bioRxiv - Molecular Biology 2023Quote: ... Cells was spun down and resuspended in 10U Dispase (Stem Cell Technologies, #07923) and 1000U DNase (Worthington ...
-
bioRxiv - Molecular Biology 2023Quote: The 4th mammary glands were harvested from 6-8-week-old female mice from desired genotype and incubated in Collagenase/Hyaluronidase medium (Stem Cell Technologies, #07912) and shaken at 37°C for 2h ...
-
bioRxiv - Microbiology 2023Quote: ... Spleens were digested in spleen dissociation medium (STEMCELL Technologies, Canada) at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... CD4+ T cells were negatively isolated using the RosetteSep™ Human CD4+ T Cell Enrichment Cocktail (Stem Cell Technologies # 15061) or the EasySepTM Human Naïve CD4+ T cell Isolation Kit (Stem Cell Technologies #17953 ...
-
bioRxiv - Microbiology 2023Quote: ... Tissue culture dishes were treated with Anti-Adherence Rinsing Solution (STEMCELL Technologies™). EBs were cultured in expansion medium until day 25 with medium changes every 2-3 days ...
-
bioRxiv - Microbiology 2023Quote: ... embryoid bodies (EB) were formed by Accutase™ (STEMCELL Technologies™) dissociation of hiPSCs and seeding 3.6 x106 cells/well in AggreWell™800 plates (STEMCELL Technologies™) ...
-
bioRxiv - Microbiology 2023Quote: ... or the EasySepTM Human Naïve CD4+ T cell Isolation Kit (Stem Cell Technologies #17953) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... iPSCs were seeded into 24-well Aggrewell 800 well plates (STEMCELL Technologies, 34811) to form embryoid bodies (EBS ...