Labshake search
Citations for Harvard Apparatus :
151 - 200 of 361 citations for 6H Dibenzo b d pyran 3 pentanaminium 6a 7 10 10a tetrahydro 1 hydroxy N N N 6 6 9 hexamethyl 6aR trans 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... A&M systems) m above the tip of the recording electrode (tip diameter: 2-3 μm, impedance: 15-20 MΩ, Harvard Apparatus). The pipette was lowered into the LC ...
-
bioRxiv - Neuroscience 2021Quote: ... Recording electrodes with impedance of 3-5 MΩ were pulled from borosilicate glass capillaries (Harvard Apparatus, Kent, UK; 1.5 mm OD) using a micropipette electrode puller (DMZ Universal Puller) ...
-
bioRxiv - Neuroscience 2022Quote: ... were delivered five times at 950-ms intervals by using 3-mm tweezer-type electrodes and an electroporator (BTX ECM 830, Harvard Apparatus). Embryos were returned to their dam and allowed to develop until they were harvested for analysis.
-
bioRxiv - Neuroscience 2020Quote: ... Retro AAV viral construct was injected (3 x 200 nl) via glass syringe (30-50 um diameter) using a syringe pump (Pump 11 Elite, Harvard Apparatus) bilaterally in IC ...
-
bioRxiv - Neuroscience 2021Quote: An optical window (made from two 3 mm glass coverslips and a 5 mm glass coverslip (Harvard Apparatus, Holliston, MA, USA) sealed with optical adhesive (Norland ...
-
bioRxiv - Neuroscience 2022Quote: Sample holders for fluorescent beads were built by gluing smaller coverslips (3 mm ⌀, CS-3R-0, Warner Instruments) to a 2-mm glass capillary tube (Harvard Apparatus) using silicone adhesive (Wuerth Super RTV-Silikon) ...
-
bioRxiv - Neuroscience 2023Quote: ... The firing activity of LC neurons was recorded using a recording electrode (tip diameter: 2-3 μm, impedance: 15-20 MΩ, Harvard Apparatus), which was lowered into the LC ...
-
bioRxiv - Neuroscience 2020Quote: ... A similar electrode was inserted in a borosillicated glass (GC150F-10, Harvard apparatus) electrode (4-6 Ohm resistance when immersed the bath ...
-
bioRxiv - Neuroscience 2022Quote: ... Patching pipettes were made with thick-walled borosilicate glass (GC150TF-10; Harvard Apparatus) pulled using a horizontal puller (P-97 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Injection of a contro or Gfral ASO (GGTATATTTTGATAGAAGAACC) was performed using a Pump 11 Elite Nanomite pump and Nanomite Injector Unit (Harvard Apparatus; Catalog# 70-4507, Serial# D-301251) at a rate of 2 μL/min ...
-
bioRxiv - Bioengineering 2023Quote: ... The cells were loaded into a 20 ml syringe and injected into the device at a flow rate of 2 ml/min for low-speed mode and 3 ml/min for high-speed mode using a syringe pump (PHD ULTRA Syringe Pumps, Harvard Apparatus, USA). To implement the recirculation strategy ...
-
bioRxiv - Neuroscience 2024Quote: ... EVs were delivered in multiple microinjections over 3 minutes using air pressure from a PLI-100A Pico-Injector (Harvard Apparatus, Cambridge, UK), and were allowed to diffuse during 4 minutes before the needle was withdrawn ...
-
bioRxiv - Neuroscience 2021Quote: ... The injectors were connected to Hamilton syringes (10 µl; 1701, Harvard Apparatus, Holliston, MA), and the infusion was controlled by an automatic pump at a rate of 0.1 µl/min (Harvard Apparatus ...
-
bioRxiv - Neuroscience 2020Quote: ... Recordings were performed using thick-walled borosilicate glass pipettes (GC100F-10; Harvard Apparatus, UK) pulled to 6-7 MΩ using a horizontal puller P-1000 (Sutter Instruments ...
-
bioRxiv - Neuroscience 2021Quote: ... The injectors were connected to Hamilton syringes (10 μl; 1701, Harvard Apparatus, Holliston, MA), and the infusion was controlled by an automatic pump at a rate of 0.1 μl/minute (Harvard Apparatus ...
-
bioRxiv - Neuroscience 2021Quote: ... Recordings were made using 4-7MΩ borosilicate glass microelectrodes (GC150F-10, Harvard apparatus, Kent). Electrodes were filled ...
-
bioRxiv - Neuroscience 2021Quote: ... Patch pipettes (1.9–2.7 MOhm) were pulled from borosilicate glass (GC150TF-10, Harvard Apparatus) on a DMZ-Universal Puller (Zeitz Instruments ...
-
bioRxiv - Neuroscience 2021Quote: Loose patch recordings were performed using borosilicate glass electrodes (GC100TF-10; Harvard Apparatus, UK) pulled to resistance between 1.0 – 1.5 MΩ ...
-
bioRxiv - Biophysics 2022Quote: ... Pipettes were pulled from borosilicate capillaries GC 150TF-10 (Harvard Apparatus, Holliston, MA, USA). Tetramethylammonium (TMA+ ...
-
bioRxiv - Neuroscience 2022Quote: ... The injectors were connected to Hamilton syringes (10 μl; 1701; Harvard Apparatus, Holliston, MA), and infusion of 1 μl of virus was controlled by an automatic pump at a rate of 0.1 μl/min (Harvard Apparatus ...
-
bioRxiv - Neuroscience 2019Quote: Recording electrodes were pulled from borosilicate glass capillaries (# 30-0044/ GC120F-10; Harvard apparatus, UK) using a horizontal micropipette puller (# P97 ...
-
bioRxiv - Biochemistry 2019Quote: ... electroporated 285 V/10 ms in a BTX square-wave electroporator (Harvard Apparatus, Holliston, MA), resuspended in 10 mL RPMI10 ...
-
bioRxiv - Neuroscience 2021Quote: ... was connected to a 10 μl Hamilton syringe mounted in an automated pump (Harvard Apparatus) to allow for remote micro-infusion without disturbing the animals during experimentation ...
-
bioRxiv - Neuroscience 2020Quote: ... was infused (Pump 11 Elite Nanomite, Harvard Apparatus, using a 10 uL WPI Nanofil syringe) in 6 specular sites bilaterally ...
-
bioRxiv - Physiology 2020Quote: ... The recording pipette (1.0 mm O.D. *0.58 mm I.D., GC100F-10, Harvard Apparatus, Holliston, Massachusetts) with a diameter around 20 μm was filled with Ringer’s solution and positioned on the centre of the cornea ...
-
bioRxiv - Neuroscience 2022Quote: ... The reference electrode was made of standard patch-clamp glass (GC150F-10, Harvard Apparatus, USA) and filled with ACSF containing (in mM) ...
-
bioRxiv - Plant Biology 2022Quote: ... a borosilicate glass capillary with an internal filament (GC150F-10, Harvard Apparatus, Cambridge, MA, USA) was pulled and filled with 500 mM KCl solution ...
-
bioRxiv - Neuroscience 2023Quote: ... Injectors were connected to 10 µl Hamilton syringes mounted on an infusion pump (Harvard Apparatus) via PE-20 tubing ...
-
bioRxiv - Neuroscience 2024Quote: ... was placed in the OFC (AP: +3; ML: +2; DV: -5, in mm from bregma and dura) and a glass microelectrode (PG150-T, Harvard Apparatus, Holliston, MA, USA) filled with 0.4 M NaCl solution was lowered in the DMS (AP ...
-
bioRxiv - Microbiology 2019Quote: ... Injection needles were made from glass capillaries (30-0050 GC120TF-10, Harvard Apparatus Limited (Holliston, MA)) using a P-97 Flaming/Brown Micropipette Puller (Sutter Instruments ...
-
bioRxiv - Neuroscience 2021Quote: ... A 10 µl Hamilton syringe placed in a motorized syringe pump (Harvard Apparatus Pump 11 Elite) was loaded with the GCaMP6s virus (AAV9.Syn1.GCaMP6s.WPRE.SV40 ...
-
bioRxiv - Plant Biology 2022Quote: ... Patch pipettes were prepared from Harvard glass capillaries (Harvard glass capillaries GC150T-10, Harvard Apparatus, UK) and typically had a resistance in the range of 1.4-3.1 MΩ ...
-
bioRxiv - Neuroscience 2021Quote: ... Patch pipettes were made from 1.50 OD/0.86 ID borosilicate glass capillaries (GC150F-10; Harvard Apparatus) using a P-97 micropipette puller (Sutter Instruments ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Injections were delivered at a rate of 10 nl/min using a motorized pump (Harvard Apparatus). The needle was left in place for 5 minutes after each injection to minimize upward flow of viral solution after raising the needle ...
-
bioRxiv - Neuroscience 2020Quote: ... Recording pipettes were fabricated by pulling (Narishige PC-10, Japan) borosilicate glass (GC150F, Harvard Apparatus, UK) to a tip resistance of 4–6 MΩ when filled with an internal solution ...
-
bioRxiv - Developmental Biology 2022Quote: ... Whole cell recordings were carried out using borosilicate glass electrodes (GC100TF-10; Harvard Apparatus, Edenbridge, UK), fire-polished to resistances of between 16-20 MΩ ...
-
bioRxiv - Immunology 2020Quote: ... cells were injected into 10 animals simultaneously using a multiport Microinfusion Syringe Pump (Harvard Apparatus, Holliston, MA). Animals were anesthetized with xylazine/ketamine during the procedure ...
-
bioRxiv - Physiology 2020Quote: ... needles were pulled from glass capillaries (GC100F-10, 1mm outer diameter, 0.58 mm inner diameter, Harvard Apparatus) using the Flaming/Brown micropipette puller (Model P-97 ...
-
bioRxiv - Neuroscience 2020Quote: ... Penn Vector Core) was injected over 10 min using a syringe pump (11 Elite, Harvard Apparatus, CA). A fibre optic cannula was implanted at DV −8.0 mm (0.1 mm above the virus injection site ...
-
bioRxiv - Developmental Biology 2022Quote: ... Microinjection needles were pulled manually from glass capillaries (GC100F-10, 1.0mm O.D; 0.58 mm I.D, Harvard Apparatus) using a Sutter P-97 ...
-
bioRxiv - Immunology 2021Quote: ... electroporated at 285 V for 10 ms in a BTX square-wave electroporator (Harvard Apparatus, Holliston, MA), resuspended in RPMI10 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Microinjection needles was made from glass capillary tubes (GC100F-10, 1.0 mm O.D; 0.58 mm I.D; Harvard Apparatus) pulled with a Sutter P-97 micropipette needle puller ...
-
bioRxiv - Neuroscience 2021Quote: ... connected by a tubing to a 10 ml Hamilton syringe in an infusion pump (model 1200, Harvard Apparatus). Injections were performed to target the Intralaminar thalamus (IL ...
-
bioRxiv - Neuroscience 2021Quote: ... to a 10 uL Hamilton syringe (Hamilton, 1701N) on a pump (Pump 11 Elite, Harvard Apparatus, 704, 501). An optical fiber implant was inserted into the NAcS (AP +1.2 mm ...
-
bioRxiv - Neuroscience 2022Quote: ... The injector cannula was connected to a 10-µL Hamilton syringe attached to an infusion pump (Harvard Apparatus). The injector cannula projected an additional 1 mm ventral to the tip of the guide cannula ...
-
bioRxiv - Neuroscience 2022Quote: ... Recording and suction pipettes were pulled from thick-wall borosilicate capillaries with filament (GC100F-10, Harvard Apparatus, UK) using a Flaming/Brown Micropipette Puller ...
-
bioRxiv - Neuroscience 2019Quote: ... Stimulation pipettes were pulled from double barrel borosillicate theta-glass (∼10 μm tip diameter, Harvard Apparatus, Edenbridge, U.K.) and filled with ACSF or a 1M NaCl solution and connected to a constant current stimulus isolator used to generate 0.1-10 mA pulses ...
-
bioRxiv - Neuroscience 2020Quote: ... The injector cannulas were connected to a 10-μL Hamilton syringe attached to an infusion pump (Harvard Apparatus). The injector cannula projected an additional 1 mm ventral to the tip of the guide cannula ...
-
bioRxiv - Neuroscience 2020Quote: ... The virus was injected with a glass pipette (10 – 20 μm tip diameter) using a syringe pump (Harvard Apparatus). To observe the OFC axons in V1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were electroporated with 10 μg of DNA using the BTM-830square waves generator (BTX Instrument Division, Harvard Apparatus). Selection of stable clones was achieved with selective doses of either zeocin (25 μg/mL ...