Labshake search
Citations for Harvard Apparatus :
1 - 50 of 1892 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... mice were intubated and connected to a rodent ventilator (Hugo Sachs Elektronik - Harvard Apparatus, D-79232 March, Germany). An incision of the chest was made in the third intercostal space and the pericardium was opened ...
-
bioRxiv - Neuroscience 2024Quote: ... 200 nl of vehicle or CNO (2 μg/μl of CNO dissolved in DMSO suspended in saline) (Chang and Gean, 2019) was infused per hemisphere over 1 minute into CA2 using a syringe pump (Harvard apparatus) mounted with a 1 μl syringe (Hamilton) ...
-
bioRxiv - Neuroscience 2024Quote: ... controlled by an injection pump (Harvard Apparatus). All viruses were injected at a volume of 1 µL and a rate of 100nL/min (unless otherwise mentioned) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Recording pipettes were made from borosilicate glass (GC210F-10; Harvard Apparatus) with a Flaming-Brown P-97 puller (Sutter Instruments ...
-
bioRxiv - Neuroscience 2024Quote: ... the cerebellum was removed prior to placing the brain cortex-side up in a coronal rat brain matrix (Harvard Apparatus, Holliston, MA). Two mm-thick cortical tissue sections (approximately 4.5-2.5 mm anterior to bregma ...
-
bioRxiv - Neuroscience 2024Quote: ... bubbled with 95% O2 – 5% CO2. Patch micropipettes (open tip resistance of approx. 6 MΩ) were pulled from borosilicate glass capillaries (Harvard Apparatus), using the Sutter Instruments P97 puller and filled with the solution containing (in mM) ...
-
bioRxiv - Systems Biology 2024Quote: ... Syringe pumps (PHD 2000, Harvard Apparatus, Holliston, MA, USA) were used in controlled liquid injection ...
-
bioRxiv - Neuroscience 2024Quote: ... Patch pipettes (2.7–4 MΩ for whole-cell patch-clamp and 6.0 and 6.5 MΩ for cell attached mode) were pulled from borosilicate glass capillaries (GC150-10, Harvard apparatus, UK) with a pipette puller (P-97 ...
-
bioRxiv - Neuroscience 2024Quote: ... microelectrodes were pulled from borosilicate glass (1.5 mm OD, 1.16 mm ID; Harvard Apparatus), and the tips were coated with refined yellow beeswax ...
-
bioRxiv - Neuroscience 2024Quote: ... All the procedures were analyzed by SMART 3.0 video tracking software (Panlab Harvard apparatus, Barcelona, Spain).
-
bioRxiv - Neuroscience 2024Quote: ... Rewards were delivered via a TTL pulse issued to an infusion pump system (Harvard Apparatus, Holliston MA). The PC running Presentation issued TTL pulses to the PC running the neural data acquisition system (Plexon ...
-
bioRxiv - Neuroscience 2024Quote: ... and diluted in sterile artificial cerebrospinal fluid (aCSF; Harvard Apparatus # 59-7316) for a final infusion concentration of 80 µM ...
-
bioRxiv - Molecular Biology 2024Quote: ... Injection of a contro or Gfral ASO (GGTATATTTTGATAGAAGAACC) was performed using a Pump 11 Elite Nanomite pump and Nanomite Injector Unit (Harvard Apparatus; Catalog# 70-4507, Serial# D-301251) at a rate of 2 μL/min ...
-
bioRxiv - Physiology 2024Quote: ... All solutions continuously superfused the cultured cells with a gravitational-driven 6-channel perfusion system through a miniature manifold (MM-6; Harvard Apparatus) at a rate of ∼0.75 ml/min ...
-
bioRxiv - Physiology 2024Quote: ... Borosilicate capillaries with filament (GC-150F-10, Harvard Apparatus, Holliston, MA, USA) were pulled using a horizontal micropipette puller (P-1000 ...
-
bioRxiv - Physiology 2024Quote: ... Coverslips were then mounted in a Teflon chamber (MSC TD, Harvard Apparatus, Holliston, MA, USA) on the stage of an Olympus IX70 inverted microscope and imaged with a 20× NA 0.75 objective ...
-
bioRxiv - Neuroscience 2024Quote: ... Filamented borosilicate microelectrodes (GC150TF-7.5, Harvard Apparatus) were coated with beeswax and fire-polished using a microforge (Narishige ...
-
bioRxiv - Microbiology 2024Quote: ... all protein digests were desalted using C18 microspin columns (Harvard Apparatus, Holliston, USA) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: ... and the syringes were pushed by Harvard Apparatus Pico Plus Elite syringe pumps (Harvard Apparatus ...
-
bioRxiv - Neuroscience 2024Quote: The rotarod apparatus (Panlab Harvard Apparatus, Cornella, Spain) was set up in acceleration mode with a range of 4 to 40 rpm such that the maximum speed was reached in 300 seconds ...
-
bioRxiv - Systems Biology 2024Quote: ... Each supernatant underwent desalting with a C18 Ultra-Micro SpinColumn (Harvard apparatus) using the standard protocol ...
-
bioRxiv - Microbiology 2024Quote: ... which was performed as previously described.42 Shear flow was applied by a syringe pump (PHD22/2000, Harvard Apparatus) into a microfluidic chip with a 100 μm × 1 mm× 15 mm main flowing zone ...
-
bioRxiv - Molecular Biology 2024Quote: ... Microelectrodes (borosilicate capillaries 1.2 mm OD, 0.94 mm ID, Harvard Apparatus) were backfilled with 3 M KCl ...
-
bioRxiv - Microbiology 2024Quote: ... The syringes were controlled by syringe pumps (PHD Ultra, Harvard Apparatus, MA) to maintain a constant flow rate.
-
bioRxiv - Microbiology 2024Quote: ... Syringes with the aqueous cell suspensions and with the oil were mounted on two separate syringe pumps (Harvard Apparatus, Pump 11 Elite / Pico Plus Elite OEM Syringe Pump Modules ...
-
bioRxiv - Neuroscience 2024Quote: ... One μL of vector per hemisphere was injected at a speed of 100 nL/min using a Microsyringe Pump Controller Micro4 (Harvard Apparatus). MCT4f/f or MCT1f/f mice received either AAV-PhP.eB-GFAP (0.7)-EGFP-T2A-iCre virus (aMCT4 KD or aMCT1 KD mice ...
-
bioRxiv - Neuroscience 2024Quote: ... Injections were carried out at 150 nL/min using finely beveled glass micropipettes connected via high-pressure tubing (Kopf) to 10 μl gastight syringes under the control of microinfusion pumps (Harvard Apparatus). Needles were left in place for 6 minutes prior to being slowly retracted ...
-
bioRxiv - Neuroscience 2024Quote: ... A 10 min injection (30 nl/min, 300 nl) process was controlled by an Elite nanomite pump (Pump 11, Harvard Apparatus). The glass micropipette was kept in place for 5 min after injection ...
-
bioRxiv - Neuroscience 2024Quote: ... and the vertebral column (L1) was fixed with spinal adaptors (Harvard Apparatus). Muscles ...
-
bioRxiv - Neuroscience 2024Quote: MONs were maintained in an oxygenated (1.5 L/min) interface perfusion chamber (Harvard Apparatus Inc.) and continuously superfused (0.6-1 mL/min ...
-
bioRxiv - Neuroscience 2024Quote: ... balance N2 (air control) – was delivered at a flow rate of 2 mL/min using a syringe pump (PHD 2000, Harvard Apparatus). Video-recording started immediately after the droplet dried and animals started crawling on the agar surface ...
-
bioRxiv - Neuroscience 2024Quote: ... The recorded video file was analyzed with the SMART video tracking system (v3.0, Harvard Apparatus) to evaluate the percentage of time spent in the open arms (time spend in open arms / (total time spent in open + closed arms ...
-
bioRxiv - Neuroscience 2024Quote: ... The test was performed under dim lighting at 12 lux in a quiet environment and recorded by SMART video tracking system (v3.0, Harvard Apparatus). This procedure consisted of 7 steps ...
-
bioRxiv - Neuroscience 2024Quote: ... The recorded video file was analyzed with the SMART video tracking system (v3.0, Harvard Apparatus). The open field arena was cleaned with 70% ethanol and wiped with paper towels between each trial ...
-
bioRxiv - Neuroscience 2024Quote: Behavioral experiments were analyzed with SMART (Harvard Apparatus), Ethovision (Noldus ...
-
bioRxiv - Neuroscience 2024Quote: ... and respiratory quotient (RQ) were measured using an indirect open-circuit calorimeter (Oxylet M3 system; PanLab/Harvard Apparatus, MA, USA). Mice were allowed to adapt for 12 hours before data were recorded for 24 hours (light and dark cycles).
-
bioRxiv - Neuroscience 2024Quote: ... Patch pipettes were fabricated from thick-walled borosilicate glass capillaries (GC150F, Harvard Apparatus Inc., Cambridge, UK) using a two-step vertical puller (PC-10 ...
-
bioRxiv - Neuroscience 2024Quote: ... A homeothermic pad and monitoring system (Harvard Apparatus, 50-7220F) was used to maintain a body temperature of 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... and the syringes were pushed by Harvard Apparatus Pico Plus Elite syringe pumps (Harvard Apparatus, cat. # 70–4506). Tubing from chamber outlet channels was fed to effluent waste collection.
-
bioRxiv - Neuroscience 2024Quote: ... was placed over the dorsal telencephalon above the uterine muscle and four 36 mV pulses (50 ms pulse duration separated by 500 ms interval) were applied with a BTX ECM830 pulse generator (Harvard Apparatus). Following electroporation ...
-
bioRxiv - Neuroscience 2024Quote: ... the anode of a Tweezertrode (Harvard Apparatus) was placed over the dorsal telencephalon above the uterine muscle and four 36 mV pulses (50 ms pulse duration separated by 500 ms interval ...
-
bioRxiv - Immunology 2024Quote: Mice were placed in arm B of the Y maze (Harvard Apparatus Cat#76-0079) and left to explore the maze for 5 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... was microinjected (100 nL) with a Hamilton syringe attached to an internal cannula (Plastics One) and microliter syringe pump (PHD Ultra, Harvard Apparatus) into the lPBN of mice immediately before the formalin test (see above).
-
bioRxiv - Neuroscience 2024Quote: PNKD-Tg mice (N= 9) and their WT littermates (N= 7) were implanted with a microdialysis probe cannula (CMA7/2 mm, Harvard Apparatus) above the dorsal striatum ...
-
bioRxiv - Neuroscience 2024Quote: Juxtacellular in vivo recordings were performed with a glass microelectrode (PG150-T, Harvard Apparatus, Holliston, MA, USA) filled with 0.4 M NaCl solution containing 2% Chicago Sky Blue dye (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... Patch electrodes were made from borosilicate glass (Harvard Apparatus) and had a resistance of 2-4 MΩ ...
-
bioRxiv - Neuroscience 2024Quote: The rotarod task was used to assess motor performance and fatigue resistance in rodents using the Panlab Rota Rod model LE8205 (Harvard Apparatus, Holliston, MA). The rod was initiated to rotate at a constant initial speed of 4 RPM ...
-
bioRxiv - Neuroscience 2024Quote: ... and placed in a custom-built stereotaxic apparatus with a feedback-controlled heating pad set at 37°C (50-7053P; Harvard Apparatus). To map the vascular architecture in the spinal cord ...
-
bioRxiv - Neuroscience 2024Quote: ... mice were anesthetized under 1.5% isoflurane in 100% oxygen throughout the entire spinal window implant procedure and were placed on a feedback-controlled heating pad that maintained body temperature at 37°C (50-7053P; Harvard Apparatus). Mice were given i.p ...
-
bioRxiv - Neuroscience 2024Quote: ... EVs were delivered in multiple microinjections over 3 minutes using air pressure from a PLI-100A Pico-Injector (Harvard Apparatus, Cambridge, UK), and were allowed to diffuse during 4 minutes before the needle was withdrawn ...