Labshake search
Citations for Macherey-Nagel GmbH :
101 - 150 of 724 citations for Protein DNA Interaction Assay since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... for NucleoSpin® DNA FFPE XS (Macherey-Nagel) and QIAamp DNA Micro (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA fragments were purified using NucleoSpin (Macherey-Nagel) and diluted to 1/100 for input and to the half for immunoprecipitated fractions ...
-
bioRxiv - Genomics 2021Quote: ... Mini kit for DNA from blood (Macherey-Nagel) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel). The sgRNA loci were amplified with an indexing 5′ primer (5′-aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacNNNNNN gcacaaaaggaaactcaccct ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) and treated by DNase-free RNase A followed by ethanol precipitation ...
-
bioRxiv - Neuroscience 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) or QIAamp® DNA Mini (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4°C and the supernatant was added to Ni-NTA columns and His-tagged proteins were purified according to the Protino Ni-TED protein purification kit (Macherey-Nagel, Düren, Germany).
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted by phenol-chloroform extraction followed by column clean-up using NucleoSpin® DNA Plant II kit (Macherey-Nagel). Clustering and DNA sequencing of wild-type ...
-
bioRxiv - Genetics 2021Quote: ... DNA from three female and three male fifth instar larvae was isolated individually using the NucleoSpin DNA Insect kit (Macherey-Nagel). We observed that the primers Masc_F1 and Masc_R1 targeting EkMasc and EkMascB consistently showed off-target amplification in female samples ...
-
bioRxiv - Neuroscience 2022Quote: ... Mature worms were frozen as whole at − 20°C and DNA was later extracted using NucleoSpin Tissue Mini kit for DNA from cells and tissue (Macherey-Nagel). PCR was performed with OneTaq Quick-Load 2x Master Mix with Standard Buffer (New England Biolabs) ...
-
bioRxiv - Genomics 2020Quote: ... and used for DNA extraction using the NucleoSpin Plant midi DNA extraction kit following the manufacture’s protocol (Macherey-Nagel, Düren, Germany). The genomic DNA was quality controlled using a Qubit® 3.0 Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: Genomic DNA was extracted from ~100 mg of feces with the use of a Nucleospin DNA Stool Kit (740472, Macherey-Nagel) according to the manufacturer’s instructions with the following modifications ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA from a male wild type blood sample (2 ml) was purified with the NucleoBand®HMW DNA Kit (Macherey-Nagel). To eliminate fragments below 40 kb the Short Read Elimination Kit XL (Circulomics ...
-
bioRxiv - Genomics 2020Quote: ... the genomic DNA from the edited cells was isolated after the transduction for eight days using a DNA isolation kit (NucleoSpinBlood - Macherey-Nagel). The target region for base editing was amplified using the respective primers (Sup Tables 2 and 3) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the total genomic DNA from plasmids was extracted from fresh transformed bacteria using a plasmid DNA Maxi Prep kit (Nucleobond XtraMaxi EF, Macherey-Nagel). Transgenic control GFP fluorescent marker expressing line (NB30 ...
-
bioRxiv - Microbiology 2023Quote: Genomic DNA was extracted from only the 13C-acetate grown cultures that yielded enough DNA at 94 days of incubation using the NucleoSpin Microbial DNA kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The 0.22 µm membrane was used for bacterial DNA isolation using NucleoMag DNA/RNA Water Kit (MACHEREY-NAGEL Inc., Bethlehem, PA) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The cloned BAC DNA was extracted using NucleoBond Xtra BAC kit for large construct plasmid DNA (Macherey-Nagel, catalog number 740436.25). For library cloning ...
-
bioRxiv - Immunology 2021Quote: ... total protein was isolated by NucleoSpin TriPrep kit (Macherey-Nagel) from 5×106 PMNs ...
-
bioRxiv - Zoology 2021Quote: ... standard DNA extraction was performed using the NucleoSpin™ Plant II DNA extraction kit (Macherey-Nagel GmbH and Co., Düren NRW, Germany). A reasonable number (usually 30–70 ...
-
bioRxiv - Genomics 2020Quote: ... Cleaved Histone-DNA complexes were isolated by centrifugation and DNA was extracted with a NucleoSpin PCR Clean-up kit (Macherey-Nagel, 740609).
-
bioRxiv - Microbiology 2020Quote: We extracted DNA from the biomass pellets stored at −20°C using a NucleoSpin® Microbial DNA Kit (Macherey-Nagel, Düren, Deutschland), according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... Total genomic DNA was extracted from a fresh stem slice using NucleoSpin® Plant II DNA extraction kit (Macherey-Nagel, Düren, Germany) and quantified using a Qubit 2.0 device (Life Technologies ...
-
bioRxiv - Plant Biology 2022Quote: ... O23 and d44a genomic DNA was extracted from liquid-cultured aerial hyphae using the NucleoBond high-molecular-weight DNA kit (MACHEREY-NAGEL, Germany). The genomic DNA was processed through the short-read eliminator kit XL (Circulomics) ...
-
bioRxiv - Genetics 2021Quote: ... DNA was extracted following using NucleoSpin columns (Macherey-Nagel) and eluted in 30 µL of NE buffer ...
-
bioRxiv - Genomics 2022Quote: ... the DNA was purified using NucleoSpin columns (Macherey-Nagel) and sequenced on a NextSeq 500 Illumina sequencer.
-
bioRxiv - Microbiology 2019Quote: ... plus the NucleoSpin RNA/DNA Buffer Set (Macherey-Nagel) procedures ...
-
bioRxiv - Physiology 2020Quote: ... NucleoSpin Tissue DNA purification kit (Macherey-Nagel, Dueren, Germany) was used to extract total DNA from adipose tissue according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmid DNA was purified by NucleoSpin column (Macherey-Nagel), then analysed on a 1% agarose gel containing RedSafe™ (Sigma-Aldrich ...
-
bioRxiv - Genomics 2021Quote: ... the DNA was purified using NucleoSpin columns (Macherey-Nagel) and sequenced on a NextSeq 500 Illumina sequencer.
-
bioRxiv - Genomics 2021Quote: ... the DNA was purified using NucleoSpin columns (Macherey-Nagel) and sequenced on a NextSeq 500 Illumina sequencer.
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was extracted (Macherey-Nagel Nucleospin kit, Cat # 740609.250) and subcloned into pGEM-T vector (Promega) ...
-
bioRxiv - Neuroscience 2020Quote: ... Plasmid DNA was purified with NucleoBond (Macherey-Nagel, Germany). 2A encodes for a ribosomal skip sentence ...
-
bioRxiv - Systems Biology 2023Quote: ... genomic DNA was harvested (Macherey-Nagel Midi Prep kit) and amplified using NEB Next Ultra II Q5 master mix and primers containing TruSeq Indexes for NGS analysis ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was purified using a MaxiPrep Kit (Macherey-Nagel). Plasmid stocks were deep-sequenced to ensure complete representation.
-
bioRxiv - Microbiology 2023Quote: ... Mini kit for plasmid DNA (Macherey-Nagel, Cat. # 740588) or Plasmid Plus Maxi Kits (QIAGEN ...
-
bioRxiv - Cell Biology 2023Quote: ... Extracted DNA was eluted in NE buffer (Macherey-Nagel) and quantified with dsDNA HS assay kit (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... the Genomic DNA from Microorganisms Kit (Macherey-Nagel, Germany) was used as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: Genomic DNA was isolated using the NucleoSpin® RNA II and NucleoSpin® RNA/DNA Buffer Set kit (MACHEREY-NAGEL, Düren, Mannheim, Germany) kit according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: The genomic DNA of Rhodococcus strain IGTS8 was isolated using the NucleoSpin Tissue DNA Extraction kit (Macherey-Nagel, Lab Supplies Scientific SA, Hellas) according to the manufacturer’s instructions ...
-
bioRxiv - Zoology 2019Quote: ... Total genomic DNA extraction was performed using the NucleoSpin™ Plant II DNA extraction kit (Macherey-Nagel GmbH and Co., Düren NRW, Germany).
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 x 109 cells were used for extraction of genomic DNA using the Macherey-Nagel NucleoSpin Microbial DNA purification kit (Macherey-Nagel, Düren, Germany). PCR-free libraries (microbial short insert libraries ...
-
bioRxiv - Genomics 2022Quote: ... then genomic DNA was isolated using the Sodium Dodecyl Sulfate (SDS) procedure of the NucleoSpin Plant II DNA isolation kit (Macherey-Nagel, Dueren, Germany). Preparation of DNA libraries for bisulfite sequencing was performed as described in (Nunn et al. ...
-
bioRxiv - Evolutionary Biology 2024Quote: We isolated total genomic DNA from silica-dried or herbarium leaf tissue using the NucleoSpin Plant II kit: Genomic DNA from plants (Macherey-Nagel, Düren, Germany) following a modified version of the manufacturer’s manual (Supplementary Data Table S4) ...
-
bioRxiv - Genomics 2024Quote: DNA was extracted using either the OmniPrep Genomic DNA Purification Kit (G Biosciences, St. Louis, MO, USA) or the Nucleospin Plant II midi DNA Extraction Kit (Macherey-Nagel, Düren, Germany). DNA quality was assessed using a Qubit fluorometer (Themo Fisher Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... Proteins were batch-purified using Ni-NTA agarose resin (Macherey-Nagel) and eluted using the abovementioned lysis buffer with increased imidazole concentration (250 mM) ...
-
bioRxiv - Biochemistry 2021Quote: ... the His-tagged protein was immobilised to nickel beads (Macherey-Nagel), eluted with 300 mM imidazole ...
-
bioRxiv - Microbiology 2022Quote: ... A sample of 100 mg of the ground powder (or as much as was available) was subject to DNA extraction using a NucleoSpin™ DNA Stool Kit (Macherey-Nagel, Oensingen, Switzerland). We found only one sample of overwintered leaves hanging in a tree ...
-
bioRxiv - Neuroscience 2020Quote: ... Genotyping for the tm1a cassette was performed using gene-specific polymerase chain reaction (PCR) on DNA extracted from ear tissue using a tissue DNA extraction kit (Macherey-Nagel, Bethlehem, PA, USA) with primers suggested by the stock facility (forward ...
-
bioRxiv - Genetics 2019Quote: ... purpureus specimens from RPPN Pasmado Conservation Unit were selected and a small stem slice from each individual were collected to DNA extraction using NucleoSpin® Plant II DNA extraction kit (Macherey-Nagel, Düren, Germany). Based on the five defined criteria for primer design ...