Labshake search
Citations for Macherey-Nagel GmbH :
101 - 150 of 2097 citations for Mouse Leucine Rich Pentatricopeptide Repeat Containing LRPPRC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... NucleoSpin® plasmid isolation kit and NucleoSpin® gel and PCR clean-up kit were purchased from Macherey-Nagel (Germany). PierceTM protease inhibitor tablets EDTA free and Pierce™ high capacity Ni-IMAC resin were purchased from Thermo Scientific (international) ...
-
bioRxiv - Bioengineering 2022Quote: ... purified using PCR clean-up kit (Macherey-Nagel), and transformed in electrocompetent E ...
-
bioRxiv - Synthetic Biology 2019Quote: ... or the NucleoBond Xtra Midi kit (Macherey-Nagel). Synthetic oligonucleotides were ordered from Sigma-Aldrich or Eurofins ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or the NucleoSpin Plant II kit (Macherey-Nagel).
-
bioRxiv - Bioengineering 2020Quote: ... NucleoSpin® Plasmid EasyPure Kit (Macherey-Nagel, Germany) was used for plasmid preparation ...
-
bioRxiv - Microbiology 2021Quote: ... or cells (NucleoSpin RNA plus kit, Macherey-Nagel) at different time post-electroporation (4 hpe – 7 dpe) ...
-
bioRxiv - Microbiology 2021Quote: ... using the NucleoSpin Plasmid Mini Kit (Macherey-Nagel) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... or the NucleoSpin Blood XL kit (Macherey-Nagel), as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... produced using an endotoxin-free kit (Macherey-Nagel), were co-injected with the I-SceI meganuclease (Grabher et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... and NucleoSpin® RNA kit (Macherey-Nagel, #740955.250) according to the manufacturer’s instruction ...
-
bioRxiv - Biophysics 2022Quote: ... Plasmid preparation kits were purchased from Macherey-Nagel.
-
bioRxiv - Genomics 2022Quote: ... The Nucleospin® Tissue kit (Macherey-Nagel, Germany) was used for bacterial DNA extraction according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... were prepared by NucleoSpin RNA kit (Macherey-Nagel). Then rRNA depletion was performed with the RiboMinus Eukaryote System v2 (Invitrogen–Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... we used the Nucleospin Kit (Macherey-Nagel, USA) following manufacturer guidelines but with 60 µl instead of 100 µl of elution buffer added in the final step ...
-
bioRxiv - Molecular Biology 2020Quote: ... or a NucleoSpin RNA extraction kit (Macherey-Nagel), treated with Turbo DNase (Ambion) ...
-
bioRxiv - Genomics 2021Quote: ... Mini kit for DNA from blood (Macherey-Nagel) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... using the NucleoSpin RNA virus kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... using the NucleoSpin RNA Plus kit (MACHEREY-NAGEL GmbH & Co ...
-
bioRxiv - Genomics 2022Quote: ... or the NucleoMagVet kit (Macherey-Nagel, Düren, Germany) on a KingFisher® extraction platform (Thermo-Fisher-Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... kit with NTB binding buffer (#740595.150, Macherey-Nagel) according to the manufacturer’s instructions and eluted in 30 µL.
-
bioRxiv - Neuroscience 2023Quote: ... NucleoSpin RNA XS kit (Macherey-Nagel; Düren, Germany), or TRIzol Reagent with phenol-chloroform extraction (Thermo-Fisher Scientific ...
-
bioRxiv - Zoology 2023Quote: ... or the NucleoSpin® Tissue Kit (Macherey-Nagel). At least one specimen per site was sequenced for two standard markers ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel). The sgRNA loci were amplified with an indexing 5′ primer (5′-aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacNNNNNN gcacaaaaggaaactcaccct ...
-
bioRxiv - Genomics 2022Quote: ... NucleoSpin miRNA Plasma Kit (NUC; Macherey-Nagel, 740981.50), QIAamp ccfDNA/RNA Kit (CCF ...
-
bioRxiv - Developmental Biology 2023Quote: ... and protein extraction kit (Macherey-Nagel, Allentown, PA) (gene expression studies ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified using Nucleospin kit (Macherey-Nagel, Düren, Germany), and subcloned into pGEM-T plasmid ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) and treated by DNase-free RNase A followed by ethanol precipitation ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and plasmid kits were purchased from Macherey-Nagel. Precision Plus ProteinTM protein standard was provided by Biorad ...
-
bioRxiv - Neuroscience 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) or QIAamp® DNA Mini (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: ... using the NucleoSpin RNA purification kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... Plasmid preparation kits were purchased from Macherey-Nagel.
-
bioRxiv - Cell Biology 2023Quote: ... or NucleoBond Xtra Midi EF kit (MACHEREY-NAGEL).
-
bioRxiv - Microbiology 2024Quote: ... RNA extraction (Macherey-Nagel RNA extraction kit; Germany) was done according to supplier instructions ...
-
bioRxiv - Plant Biology 2019Quote: Total RNA of seedlings was extracted using either the innuPREP Plant RNA kit (analytic-jena) or the NucleoSpin RNA Plant kit (Macherey-Nagel). If necessary ...
-
bioRxiv - Genetics 2021Quote: ... The lysates were then purified to genomic DNA and RNA using NucleoSpin Tissue Kits and NucleoSpin RNA Plus kits (MACHEREY-NAGEL), respectively ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted from single legs of individual mosquitoes or whole individual mosquitoes using NucleoSpin DNA Insect Kit (Machery-Nagel) or NucleoSpin Tissue Kit (Macherey-Nagel) following the manufacturers’ instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting PCR product was purified using a standard PCR purification kit (NucleoSpin® Gel and PCR Clean-up kit, Macherey-Nagel) and used as a template for the second PCR that used the gene-specific forward primer and a 3’ T7 universal reverse primer targeting the forward linker sequence for the antisense probe ...
-
bioRxiv - Microbiology 2023Quote: ... exonuclease V was used to digest the linear DNA in the sample prior to isolation of the residual putative cirDNA using a DNA clean-up kit (NucleoSpin gel and PCR clean-up kit, Macherey-Nagel, Germany). The final cirDNA preparation was dissolved in TE buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA from CD11B+ cells was extracted using an RNA XS Plus extraction kit and that from brains using a NucleoSpin RNA extraction kit according to the manufacturers’ protocol (Macherey-Nagel®). Reverse transcription was performed using 350 ng (CD11B+ ...
-
A randomized multiplex CRISPRi-Seq approach for the identification of critical combinations of genesbioRxiv - Genetics 2023Quote: ... bacteria from the cultures used for infection were immediately pelleted by centrifugation and resuspended in 8 mL of RES-EF of the NucleoBond Xtra Midi EF kit prior to proceeding with the standard kit protocol (Macherey-Nagel 740420.50). Precipitated vectors were resuspended in 120 µL of water.
-
bioRxiv - Immunology 2023Quote: ... Total RNA (0.2–0.4 mL) of mouse whole blood was isolated using NucleoSpin RNA Blood (Macherey-Nagel GmbH & Co.) according to the manufacturer’s instructions with on-column DNA digestion ...
-
bioRxiv - Microbiology 2020Quote: ... coli using NucleoSpin Plasmid Kit (Macherey-Nagel, Düren, Germany). Deletion of the degU ...
-
bioRxiv - Evolutionary Biology 2021Quote: We used NucleoSpin Tissue kits (Macherey-Nagel, Düren, Germany) to extract and purify genomic DNA from the hind femur of each individual ...
-
bioRxiv - Developmental Biology 2020Quote: ... using NucleoSpin® RNA kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: For tissue extraction the RNA purification Kit (Macherey-Nagel) was used ...
-
bioRxiv - Molecular Biology 2021Quote: ... and a NucleoSpin RNA isolation kit (Macherey-Nagel, Germany). Hundreds of worms were collected for each experiment ...
-
bioRxiv - Molecular Biology 2019Quote: RNA was isolated with Nucleospin RNA kit (Macherey-Nagel) with DNase I treatment ...
-
bioRxiv - Microbiology 2020Quote: ... the NucleoSpin® Plasmid kit (Macherey-Nagel, Düren, Germany) was used ...
-
bioRxiv - Genomics 2021Quote: ... using the NucleoSpin Plasmid EasyPure kit #740727250 (Macherey-Nagel), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Fragments were gel purified (following kit instructions, Macherey-Nagel) and 30 ng of insert and 10 ng of vector ligated using 6U of T4 DNA ligase (Thermo ...