Labshake search
Citations for Macherey-Nagel GmbH :
1 - 50 of 2265 citations for DNA Damage 8 OHdG ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... Transformed cells were grown in Kp medium for 8-10 vegetative divisions and their genomic DNA was extracted using the NucleoSpin Tissue kit (Macherey-Nagel). Transgene injection levels (copy number per haploid genome ...
-
bioRxiv - Microbiology 2023Quote: ... VII-1-1 and IX-5-2 (Genomic DNA extraction kit, Macherey-Nagel, Hoerdt) by using the primers listed in Table S4 ...
-
bioRxiv - Evolutionary Biology 2023Quote: DNA was extracted from 8–12 mg of dried tissue using the NucleoSpin 96 Plant II kit (Macherey-Nagel GmbH & Co. KG) following manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... Rubus DNA extractions were performed in 96-well plates from freeze-dried tissue using commercial kits (e.g. Macherey-Nagel Nucleospin kit was used at PFR). Mānuka samples were collected in natural stands in remote locations using silica beads in 2mL screw cap tubes as described in Koot et al ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from 1 × 106 cells with NucleoSpin Tissue kit (Macherey-Nagel), and real-time PCR was performed on 30 ng of DNA with SYBR Green kit GoTaq® qPCR Master Mix (Promega) ...
-
bioRxiv - Genomics 2020Quote: ... The next day bacteria were floated off the plates with liquid LB medium and plasmid DNA was isolated using the NucleoBond Xtra Maxi Kit (Macherey-Nagel), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... The next day bacteria were floated off the plates with liquid LB medium and plasmid DNA was isolated using the NucleoBond Xtra Maxi Kit (Macherey-Nagel), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... cells were scraped from plates using sterile water and plasmid DNA was extracted from 400 OD600nm units (Nucleobond Xtra Midiprep Kit, Macherey-Nagel). The resulting plasmid DNA was used for yeast transformation.
-
bioRxiv - Genetics 2022Quote: ... the cells were scraped from the plates using sterile water and plasmid DNA was extracted from 400 OD600nm units (Nucleobond Xtra Midiprep Kit, Macherey-Nagel).
-
bioRxiv - Microbiology 2023Quote: ... 29-18-1 using the NucleoSpin Microbial DNA Mini kit (Macherey-Nagel, Düren, Germany), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: DNA was extracted from blood samples of patients II-8 and IV-1 using the Nucleospin extraction kit (ref 740952-Macherey-Nagel). Subsequently ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was extracted using a DNA Extraction Kit (Macherey-Nagel, #740952.50) and used for qPCR as described before [56] ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted using the NucleoSpin DNA Insect Kit (Macherey-Nagel) with NucleoSpin Bead Tubes Type E and MN Bead Tube Holder in combination with the Vortex-Genie 2 ...
-
bioRxiv - Plant Biology 2024Quote: ... Genomic DNA was extracted using plant DNA extraction kit (Macherey-Nagel). DNA samples were processed as described in Schalk et al ...
-
bioRxiv - Microbiology 2023Quote: ... PA14 and PAK from ∼1 × 108 CFU using NucleoSpin Microbial DNA Mini kit (Macherey-Nagel), as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... their genomic DNA was purified using NucleoSpin DNA RapidLyse kit (Macherey-Nagel) and subjected again to genotyping PCR ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was purified using the NucleoSpin DNA RapidLyse kit (Macherey-Nagel). The knock-in region was amplified by PCR using primers and KOD One PCR Master Mix ...
-
bioRxiv - Genomics 2023Quote: ... Genomic DNA was then extracted using NucleoSpin DNA RapidLyse kit (Macherey-Nagel).
-
bioRxiv - Immunology 2023Quote: Fecal DNA was extracted using the NucleoMag DNA Microbiome kit (Macherey-Nagel) and sequenced using the MinION from Oxford Nanopore Technologies (ONT) ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA was prepared with the NucleoSpin Microbial DNA Kit (Macherey-Nagel) and treated with 1 µL of RNase Cocktail™ Enzyme Mix (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... NucleoSpin® Microbial DNA kit (Macherey-Nagel) was used for the extraction of genomic DNA aimed for long-read sequencing ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The NucleoSpin DNA RapidLyse Kit (Macherey-Nagel) was used for the DNA extraction from the Queensland Museum archival specimen QM_G335164 ...
-
bioRxiv - Biochemistry 2021Quote: ... Mini kit for plasmid DNA (Macherey-Nagel). To obtain linear DNA of the indicated length ...
-
bioRxiv - Biophysics 2023Quote: ... Mini kit for plasmid DNA (Macherey-Nagel). Correct mutation of the plasmids was verified by sequencing performed by MicroSynth GmbH Göttingen.
-
bioRxiv - Cancer Biology 2020Quote: ... and genomic DNA extracted with the NucleoSpin DNA RapidLyse Kit (Macherey-Nagel #740100.50). Genomic DNA was normalized to 30-50 ng/µL for each sample ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA was prepared using Nucleospin DNA Plant II kit (Macherey-Nagel, Hoerdt, France) and the integration of BdPMT and F5H genes was verified by PCR using the following primers pairs ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid DNA was extracted using the NucleoSpin Plasmid DNA Kit (Macherey-Nagel, Germany).
-
bioRxiv - Bioengineering 2022Quote: ... Genomic DNA (gDNA) was extracted using a genomic DNA extraction kit (Macherey-Nagel). Primers were designed to amplify approximately 400-700 bp of the region targeted by the guide RNAs (Supplementary Table 5) ...
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA was extracted with the NucleoSpin Tissue DNA extraction kit (Macherey-Nagel). PCR products were cleaned with AMPure PB beads using the manufacturer’s instructions at a ratio of 0.6X ...
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA was extracted with the NucleoSpin Tissue DNA extraction kit (Macherey-Nagel). PCRs were run using between 10-500 pg of DNA measured by Quant-iT Qubit dsDNA HS Assay Kit (ThermoFisher ...
-
bioRxiv - Plant Biology 2020Quote: ... DNA recovered after ChIP and DNA from input chromatin was extracted by DNA isolation kit (Macherey-Nagel, Germany) and then analysed by qPCR ...
-
bioRxiv - Genomics 2021Quote: ... Mini kit for DNA from blood (Macherey-Nagel) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) and treated by DNase-free RNase A followed by ethanol precipitation ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel). The sgRNA loci were amplified with an indexing 5′ primer (5′-aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacNNNNNN gcacaaaaggaaactcaccct ...
-
bioRxiv - Neuroscience 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) or QIAamp® DNA Mini (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... Total DNA was extracted using the NucleoSpin DNA Insect Kit (Macherey-Nagel, Düren, Germany) following the instructions of the manufacturer ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... using Nucleospin DNA Stool Genomic DNA Purification Kit (Cat. No. 740472; Macherey-Nagel, Germany), as per manufacturer’s instruction ...
-
bioRxiv - Genomics 2021Quote: PA834 genomic DNA was obtained by using the NucleoSpin Microbial DNA kit (Macherey-Nagel), and genomic library was prepared using Nextera XT paired-end run with a ~500-bp insert ...
-
bioRxiv - Genomics 2023Quote: ... The genomic DNA extraction was done using the NucleoSpin Microbial DNA kit (Macherey-Nagel), and the genomic libraries were constructed using Nextera paired-end library ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... genomic DNA extractions were performed using the NucleoSpin Microbial DNA Mini kit (Macherey-Nagel) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... genomic DNA was prepared using the NucleoSpin® Microbial DNA Kit (Macherey-Nagel, Düren, Germany) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Genomic DNA was extracted using either the commercial DNA extraction kits NucleoSpin Tissue (Macherey-Nagel) or DNeasy Blood & Tissue (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: The DNA was extracted using a NucleoSpin® Microbial DNA Kit (Macherey-Nagel, Düren, Deutschland), according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Genomic DNA was extracted using a Nucleospin tissue DNA extraction Kit (Macherey-Nagel, Hoerdt, France). Each DNA sample was eluted in 100 µl of sterile water and DNA sequencing was commissioned to Novogene facility (London ...
-
bioRxiv - Genomics 2021Quote: ... Genomic DNA was isolated using a NucleoSpin Blood DNA extraction kit (Macherey-Nagel, Bethlehem PA). The sgRNA-containing region was PCR-amplified with NEBNext Ultra II Q5 MasterMix (NEB) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... mycelium DNA was extracted with the NucleoBond High Molecular Weight DNA kit from Macherey-Nagel, with the mechanical disruption of about 30 mg of lyophilized mycelium with beads for 5 min at 30 Hz ...
-
bioRxiv - Microbiology 2022Quote: DNA was extracted from isolates using a NucleoSpin Microbial DNA kit (Macherey-Nagel, Duren, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: Genomic DNA (gDNA) was extracted using a NucleoSpin Microbial DNA kit (Macherey-Nagel, PA, USA) and TissueLyser II (Qiagen ...
-
bioRxiv - Synthetic Biology 2022Quote: Genomic DNA was obtained using the NucleoBond HMW DNA kit (740160.20, Macherey-Nagel, Düren, Germany) according to the manufacturer guidelines using lyticase (#L4025 ...
-
bioRxiv - Immunology 2023Quote: Genomic DNA was isolated from tail biopsies using the NucleoSpin DNA RapidLyse kit (Macherey-Nagel) according to the manufacturer’s protocol ...