Labshake search
Citations for Macherey-Nagel GmbH :
151 - 200 of 2155 citations for Cyclic GMP cGMP ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... kit with NTB binding buffer (#740595.150, Macherey-Nagel) according to the manufacturer’s instructions and eluted in 30 µL.
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) and treated by DNase-free RNase A followed by ethanol precipitation ...
-
bioRxiv - Neuroscience 2023Quote: ... NucleoSpin RNA XS kit (Macherey-Nagel; Düren, Germany), or TRIzol Reagent with phenol-chloroform extraction (Thermo-Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel). The sgRNA loci were amplified with an indexing 5′ primer (5′-aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacNNNNNN gcacaaaaggaaactcaccct ...
-
bioRxiv - Zoology 2023Quote: ... or the NucleoSpin® Tissue Kit (Macherey-Nagel). At least one specimen per site was sequenced for two standard markers ...
-
bioRxiv - Genomics 2022Quote: ... NucleoSpin miRNA Plasma Kit (NUC; Macherey-Nagel, 740981.50), QIAamp ccfDNA/RNA Kit (CCF ...
-
bioRxiv - Developmental Biology 2023Quote: ... and protein extraction kit (Macherey-Nagel, Allentown, PA) (gene expression studies ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified using Nucleospin kit (Macherey-Nagel, Düren, Germany), and subcloned into pGEM-T plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) or QIAamp® DNA Mini (Qiagen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and plasmid kits were purchased from Macherey-Nagel. Precision Plus ProteinTM protein standard was provided by Biorad ...
-
bioRxiv - Neuroscience 2023Quote: ... using the NucleoSpin RNA purification kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... Plasmid preparation kits were purchased from Macherey-Nagel.
-
bioRxiv - Microbiology 2024Quote: ... RNA extraction (Macherey-Nagel RNA extraction kit; Germany) was done according to supplier instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... or NucleoBond Xtra Midi EF kit (MACHEREY-NAGEL).
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Extracted steroids were concentrated under nitrogen and dissolved in 20 µl of trichloromethane for separation by thin-layer chromatography on silica gel TLC plates (Macherey-Nagel, Oensingen, Switzerland). Radiolabeled steroids were quantified by autoradiography on a Fuji FLA-7000 PhosphorImager (Fujifilm ...
-
bioRxiv - Plant Biology 2019Quote: Total RNA of seedlings was extracted using either the innuPREP Plant RNA kit (analytic-jena) or the NucleoSpin RNA Plant kit (Macherey-Nagel). If necessary ...
-
bioRxiv - Genetics 2021Quote: ... The lysates were then purified to genomic DNA and RNA using NucleoSpin Tissue Kits and NucleoSpin RNA Plus kits (MACHEREY-NAGEL), respectively ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted from single legs of individual mosquitoes or whole individual mosquitoes using NucleoSpin DNA Insect Kit (Machery-Nagel) or NucleoSpin Tissue Kit (Macherey-Nagel) following the manufacturers’ instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting PCR product was purified using a standard PCR purification kit (NucleoSpin® Gel and PCR Clean-up kit, Macherey-Nagel) and used as a template for the second PCR that used the gene-specific forward primer and a 3’ T7 universal reverse primer targeting the forward linker sequence for the antisense probe ...
-
bioRxiv - Microbiology 2023Quote: ... exonuclease V was used to digest the linear DNA in the sample prior to isolation of the residual putative cirDNA using a DNA clean-up kit (NucleoSpin gel and PCR clean-up kit, Macherey-Nagel, Germany). The final cirDNA preparation was dissolved in TE buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA from CD11B+ cells was extracted using an RNA XS Plus extraction kit and that from brains using a NucleoSpin RNA extraction kit according to the manufacturers’ protocol (Macherey-Nagel®). Reverse transcription was performed using 350 ng (CD11B+ ...
-
A randomized multiplex CRISPRi-Seq approach for the identification of critical combinations of genesbioRxiv - Genetics 2023Quote: ... bacteria from the cultures used for infection were immediately pelleted by centrifugation and resuspended in 8 mL of RES-EF of the NucleoBond Xtra Midi EF kit prior to proceeding with the standard kit protocol (Macherey-Nagel 740420.50). Precipitated vectors were resuspended in 120 µL of water.
-
bioRxiv - Microbiology 2020Quote: ... coli using NucleoSpin Plasmid Kit (Macherey-Nagel, Düren, Germany). Deletion of the degU ...
-
bioRxiv - Evolutionary Biology 2021Quote: We used NucleoSpin Tissue kits (Macherey-Nagel, Düren, Germany) to extract and purify genomic DNA from the hind femur of each individual ...
-
bioRxiv - Developmental Biology 2020Quote: ... using NucleoSpin® RNA kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: For tissue extraction the RNA purification Kit (Macherey-Nagel) was used ...
-
bioRxiv - Molecular Biology 2021Quote: ... and a NucleoSpin RNA isolation kit (Macherey-Nagel, Germany). Hundreds of worms were collected for each experiment ...
-
bioRxiv - Molecular Biology 2019Quote: RNA was isolated with Nucleospin RNA kit (Macherey-Nagel) with DNase I treatment ...
-
bioRxiv - Microbiology 2020Quote: ... the NucleoSpin® Plasmid kit (Macherey-Nagel, Düren, Germany) was used ...
-
bioRxiv - Genomics 2021Quote: ... using the NucleoSpin Plasmid EasyPure kit #740727250 (Macherey-Nagel), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Fragments were gel purified (following kit instructions, Macherey-Nagel) and 30 ng of insert and 10 ng of vector ligated using 6U of T4 DNA ligase (Thermo ...
-
bioRxiv - Neuroscience 2020Quote: ... and NucleoBond Xtra Midi EF Kit (Macherey-Nagel, 740420.10) and verified them via Sanger sequencing ...
-
bioRxiv - Cancer Biology 2020Quote: ... or NucleoSpin Tissue kit (routine genotyping; Macherey-Nagel #740952.25). OneTaq DNA polymerase (New England BioLabs #M0480 ...
-
bioRxiv - Microbiology 2021Quote: ... purified (gel and PCR clean-up kit, Macherey-Nagel) and subsequently sequenced by the use of primers oRH068 ...
-
bioRxiv - Microbiology 2021Quote: ... ljungdahlii with the NucleoSpin Tissue Mini kit (Macherey-Nagel) and used as PCR-template ...
-
bioRxiv - Microbiology 2022Quote: ... NucleoSpin RNA virus kit (Macherey-Nagel; cat no. 740956.250) was used for RNA extraction.
-
bioRxiv - Cancer Biology 2022Quote: ... RNA Isolation Kit according to manufacturer’s instructions (Macherey-Nagel). RNA concentrations were measured with Nanodrop ...
-
bioRxiv - Microbiology 2021Quote: ... Mini kit for RNA purification (Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted (Nucleospin RNA kit, Macherey-Nagel, 740955). The remaining part of embryos were processed for whole-mount in situ hybridisation detection of Uncx4.1 and accurate somite count determination.
-
bioRxiv - Molecular Biology 2020Quote: ... coli cultures using NucleoBond Plasmid MAXI KIT (Macherey-Nagel) and resuspended in TE buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... the Nucleospin RNA II kit (Macherey-Nagel, Duren, Germany) was used for total RNA extraction following the manufacturer’s instruction (Gondard et al. ...
-
bioRxiv - Pathology 2020Quote: We isolated total RNA Nucleospin RNA kit (Macherey-Nagel) with DNase I treatment ...
-
bioRxiv - Physiology 2020Quote: ... NucleoSpin Tissue DNA purification kit (Macherey-Nagel, Dueren, Germany) was used to extract total DNA from adipose tissue according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... NucleoSpin Blood L kit (#740569.10) was from Macherey-Nagel. ECL Western Blotting Detection Reagent (#RPN2106 ...
-
bioRxiv - Immunology 2019Quote: ... purified (NuceloSpin Gel & PCR Clean-up Kit; Macherey-Nagel), and amplicons cloned into pCR4-TOPO (Invitrogen) ...
-
bioRxiv - Neuroscience 2019Quote: ... a Nucleospin RNA kit from Macherey-Nagel (Düren, Germany) was used and the instructions were followed as provided by the company ...
-
bioRxiv - Cell Biology 2019Quote: ... using the NucleoSpin Blood L kit (Macherey-Nagel, #740569.10) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... BACs purified using the NucleoBond BAC kit (Macherey-Nagel) and spanning genomic regions of HuweI (RP24-157H12 ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was extracted (Macherey-Nagel Nucleospin kit, Cat # 740609.250) and subcloned into pGEM-T vector (Promega) ...
-
bioRxiv - Cancer Biology 2020Quote: ... following RNA extraction with NucleoSpin RNA kit (Macherey-Nagel), reverse transcription reaction with Transcriptor First Strand cDNA Synthesis kit (Roche ...