Labshake search
Citations for Macherey-Nagel GmbH :
1 - 50 of 804 citations for Carboxypeptidase Y from Baker's Yeast since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: RNA from 10 mL yeast culture was isolated using a mini kit for RNA isolation (Macherey-NAGEL, REF 740933.50). Next ...
-
bioRxiv - Molecular Biology 2021Quote: ... total RNAs were extracted from yeast cells disrupted by bead beating and purified using the Nucleospin RNA II kit (Macherey-Nagel). For RNA-seq analysis ...
-
bioRxiv - Microbiology 2022Quote: The yeast expression vector pAG416-GAL-SARS-CoV-2-3CL was freshly prepared by Midiprep (Macherey-Nagel), and variants were introduced by a modified single primer site-directed mutagenesis method (Shenoy and Visweswariah ...
-
bioRxiv - Biochemistry 2022Quote: Total RNAs were extracted from mid-log yeast cultures grown 16 h at 20°C in YPD as described above using the Nucleospin RNA II kit (Macherey-Nagel) and were reverse transcribed with Superscript-II reverse transcriptase (Invitrogen) ...
-
bioRxiv - Genomics 2021Quote: ... and from blood using the NucleoSpin Blood QuickPure Kit (from the company Macherey-Nagel) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... and column purified with standard kits (NucleoSpin from Macherey-Nagel or PureLink from Invitrogen) before being assembled by homologous recombination and then transformed in electrocompetent Stbl4 or Dh5a bacteria (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: RNA was extracted from cells with the NucleoSpin RNA kit from Macherey-Nagel (Düren, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: RNA was extracted from sorted cells using the NucleoSpin RNA XS kit from Macherey-Nagel, quantified using a ND-1000 NanoDrop spectrophotometer (NanoDrop Technologies ...
-
bioRxiv - Zoology 2020Quote: Total RNA was isolated from specific tissues using a kit from Macherey-Nagel (Hoerdt, France). Moloney murine leukemia virus reverse transcriptase (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted from the samples using RNA isolation kits from Macherey-Nagel (Duren, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was extracted from newly matured leaves using a NucleoSpin RNA kit from MACHEREY-NAGEL according to the manufacturer’s instructions and then treated with DNase I ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA from fibroblast cells was extracted using NucleoSpin RNA Mini kit from Macherey-Nagel (#740955) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... total RNA was isolated from extracts obtained from different fractions using NucleoSpin TriPrep Kit (Macherey-Nagel) following the requirements of the manufacturer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA was extracted from 50 adults J1 malesflies using the Nucleobond AXG20 column from Macherey-Nagel. For whole genome sequencing ...
-
bioRxiv - Plant Biology 2023Quote: Nuclear DNA was isolated from desiccated leaf tissue using NucleoSpin Plant II kit from Macherey-Nagel, followed by the Ribonuclease A treatment included in the kit ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA from cell pellets was extracted and purified using the Nucleospin RNA protocol from Macherey-Nagel kit (740955) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... gDNA was extracted from 10 individuals from pools bgcn-Cas9D using the NucleoSpin Tissue kit (Macherey-Nagel). DNA was digested with the restriction enzymes BamHI ...
-
bioRxiv - Immunology 2023Quote: ... RNA from tumours was extracted and purified from tumours using the NucleoSpin RNA extraction kit (Macherey-Nagel). Library preparation and sequencing were performed by Genewiz (Leipzig ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from liver using the Genomic DNA from organs and cells Kit (Macherey-Nagel) following manufacturer’s recommendations ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... DNA from soil samples was extracted using the NucleoSpin(R) Soil kit from MACHEREY-NAGEL (REF: 740780.10).
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA from cells of interest was isolated using the NucleoSpin RNA Kit from Macherey-Nagel (Düren, Germany) according to manufacturer’s recommendation ...
-
bioRxiv - Cell Biology 2020Quote: RNA was extracted from isolated islets from 2 mice per genotype with Nucleospin RNA plus XS (Macherey-Nagel). Complementary DNA was generated and linearly amplified from 3 ng total RNA using the Ovation RNA-seq V2 system (NuGEN technologies Inc. ...
-
bioRxiv - Neuroscience 2024Quote: ... 5µm column from MACHEREY-NAGEL (Düren, Germany) was used for purification ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was isolated from iPSCs and from induced neurons after 21 DIV using RNA Plus Kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA fragments were purified from agarose gels using the NucleoSpin Gel and PCR Clean-up kit from Macherey-Nagel. Genomic DNA extractions from Amycolatopsis and E ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated from MEFs following treatment with 4µM thapsiragin over 24hrs with the NucleoSpin RNA plus from MACHEREY-NAGEL, following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and purified directly from the PCR mix or from an agarose gel (Gel and PCR clean-up kit, Macherey-Nagel); the two fragments were fused together thanks to a primer-encoded 20-30bps overlap during a second PCR amplification round and the product cloned into the pEMG suicide vector [20] using EcoRI and BamHI ...
-
bioRxiv - Microbiology 2022Quote: DNA from monolayer cultures as well as from rafts was isolated using the NucleoSpin Blood QuickPure kit (740569.250; Macherey-Nagel) according to the manufacturer’s instructions with some modifications for raft tissues ...
-
bioRxiv - Cancer Biology 2024Quote: RNA from human prostate cancer cell lines was extracted using NucleoSpin® RNA isolation kit from Macherey-Nagel (Ref: 740955.240C), following the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2022Quote: ... Plasmid preparation kits were purchased from Macherey-Nagel.
-
bioRxiv - Genomics 2021Quote: ... Mini kit for DNA from blood (Macherey-Nagel) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) and treated by DNase-free RNase A followed by ethanol precipitation ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel). The sgRNA loci were amplified with an indexing 5′ primer (5′-aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacNNNNNN gcacaaaaggaaactcaccct ...
-
bioRxiv - Biochemistry 2024Quote: ... Plasmid preparation kits were purchased from Macherey-Nagel.
-
bioRxiv - Neuroscience 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) or QIAamp® DNA Mini (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... HPLC-grade acetonitrile was purchased from Macherey-Nagel. Formvar carbon film on 200-mesh copper grids (FCF200-Cu ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and plasmid kits were purchased from Macherey-Nagel. Precision Plus ProteinTM protein standard was provided by Biorad ...
-
bioRxiv - Microbiology 2024Quote: ... DNA gel extraction kit from Macherey-Nagel (Germany), trizol reagent ...
-
bioRxiv - Cell Biology 2022Quote: ... Total RNA was isolated from wt and Uhrf1- or Usp7-knockdown BHK cells using the nucleospin triprep kit from Macherey-Nagel. 500 ng of total RNA was reverse transcribed with a high-capacity cDNA reverse transcription kit (Applied Biosystems ...
-
bioRxiv - Genetics 2022Quote: ... cells were scraped from plates using sterile water and plasmid DNA was extracted from 400 OD600nm units (Nucleobond Xtra Midiprep Kit, Macherey-Nagel). The resulting plasmid DNA was used for yeast transformation.
-
bioRxiv - Genetics 2022Quote: ... the cells were scraped from the plates using sterile water and plasmid DNA was extracted from 400 OD600nm units (Nucleobond Xtra Midiprep Kit, Macherey-Nagel).
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR products with multiple bands were excised and purified from gel using the Nucleospin Gel and PCR Clean-up kit from Macherey-Nagel, or cloned using the NEB® PCR cloning kit (New Englands BioLabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and LA1737 and LA1738 (629 bp downstream of stop codon) (Table S11) from genomic DNA prepared from our Liverpool WT colony using the NucleoSpin Tissue kit (Macherey-Nagel) and ligated into the plasmid sequentially by standard restriction enzyme-based cloning to generate bgcn-Cas9 (AGG1207).
-
bioRxiv - Molecular Biology 2020Quote: ... the total genomic DNA from plasmids was extracted from fresh transformed bacteria using a plasmid DNA Maxi Prep kit (Nucleobond XtraMaxi EF, Macherey-Nagel). Transgenic control GFP fluorescent marker expressing line (NB30 ...
-
bioRxiv - Cell Biology 2021Quote: ... flanking Cas9 targeted site was amplified from genomic DNA extracted from wild type MCF10A cells (NucleoSpin tissue extraction kit, Macherey-Nagel), Puro-T2A were amplified from the custom-made plasmid MXS Puro bGHpA using primers containing T2A sequence ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was isolated from confluent cells from one well of a 6-well plate with the NucleoSpin RNA isolation kit (Macherey-Nagel) according to manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Genomic DNA was extracted from 15 unsexed individuals conserved in alcohol using the Nucleobond AXG20 kit and buffer set IV from Macherey-Nagel (ref ...
-
bioRxiv - Evolutionary Biology 2023Quote: Whole DNA was extracted from fecal samples following the optimized protocol of (79) using the Genomic DNA from soil kit (NucleoSpin, Macherey-Nagel). Two successive extractions were done and a purification step was added to retrieve high molecular weight DNA suitable for long-read sequencing (79) ...
-
bioRxiv - Genomics 2024Quote: Total RNA was extracted from 100 mg of rosette leaves from ddm1-2 plants using the Nucleo-spin RNA Plant mini kit (Macherey-Nagel). Library preparation and Nanopore sequencing were performed as previously described (Domínguez et al ...
-
bioRxiv - Cancer Biology 2024Quote: ... the 28S and 18S bands were cut from the gel and RNA was extracted from agarose using Nucleospin Gel and PCR clean-up (Macherey-Nagel) columns.