Labshake search
Citations for Macherey-Nagel GmbH :
1 - 50 of 129 citations for Brucella Blood Agar with Hemin and Vitamin K 15x100mm plate 26ml fill since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: 800 µl of whole blood were incubated with 80 µl Proteinase K (Macherey-Nagel, Düren, Germany) for 15 min at room temperature and centrifuged at 21 000 xg and 4°C for 5 min ...
-
bioRxiv - Genomics 2021Quote: ... The resulting cultures were recovered from the LB-agar plates and a maxipreps were performed (Macherey-Nagel) to purify the plasmid DNA.
-
bioRxiv - Molecular Biology 2020Quote: ... 1mg/mL proteinase K (Macherey-Nagel) and then with 0.1 mg/mL RNaseA (Qiagen ...
-
bioRxiv - Systems Biology 2020Quote: RNA from blood was extracted using NucleoSpin RNA Blood Mini kit (Macherey-Nagel). Lysis buffer and proteinase K were added to the frozen pellet and shaken while thawing ...
-
bioRxiv - Genomics 2021Quote: ... and from blood using the NucleoSpin Blood QuickPure Kit (from the company Macherey-Nagel) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... permeabilized with 10 µg/mL Proteinase K (Macherey-Nagel) in PBS containing 0.1% tween (PBST ...
-
bioRxiv - Genetics 2024Quote: Genomic DNA was extracted from whole blood cells using the NucleoSpin Blood kit (Macherey-Nagel) or from tissue samples by a standard method involving proteinase K digestion and isopropanol precipitation ...
-
bioRxiv - Microbiology 2023Quote: Whole blood DNA was extracted using the NucleoSpin 96 Blood core kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: NucleoSpin Blood kit (Macherey-Nagel, 740951.50) was used to isolate the genomic DNA ...
-
bioRxiv - Genetics 2020Quote: DNA was extracted from blood samples using the NucleoSpin Blood kit (Macherey-Nagel, GmbH & Co. KG, Düren, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... or NucleoSpin Blood Kit (Macherey-Nagel, Germany). SV breakpoints were confirmed with Sanger Sequencing where possible ...
-
bioRxiv - Cancer Biology 2020Quote: ... 50 μg/ml proteinase K (PK, Macherey-Nagel, Düren, Germany, 740506)) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Larvae were permeabilized with 10 μg/ml Proteinase K (Macherey-Nagel) in PBS containing 0.1% tween (PBST ...
-
bioRxiv - Bioengineering 2022Quote: ... 20 µL of proteinase K (20 mg/mL; MACHEREY-NAGEL # 740506) was added and the mixture incubated at 70°C for 20 min ...
-
bioRxiv - Bioengineering 2024Quote: ... 20 µL of proteinase K (20 mg/mL; MACHEREY-NAGEL # 740506) was added and the mixture incubated at 70°C for 20 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was extracted from ethylenediaminetetraacetic acid (EDTA)-anticoagulated blood using NucleoSpin Blood Quick Pure kit (Macherey-Nagel, Duren, Germany) and was stored in the gene bank run by Azabu University (Kanagawa ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA (0.2–0.4 mL) of mouse whole blood was isolated using NucleoSpin RNA Blood (Macherey-Nagel GmbH & Co.) according to the manufacturer’s instructions with on-column DNA digestion ...
-
bioRxiv - Genomics 2023Quote: Total RNAs were extracted from blood of 137 ewes with the Nucleospin® RNA Blood Kit (Macherey-Nagel, #Ref 740200.50) according to the manufacturer’s protocol starting with 800µL of whole blood with a DNAseI digestion treatment to eliminate contaminating genomic DNA ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted from 200 μL of pelleted red blood cells diluted 1:1 in PBS1X using the DNA Nucleospin blood extraction kit following the manufacturer’s instructions (Macherey-Nagel). The extracted DNA was then stored at -20°C for later use.
-
bioRxiv - Molecular Biology 2022Quote: ... 50 mM NaCl and 1 mg/ml proteinase K (Macherey-Nagel, 740506) and 0.05 mg/ml RNase A (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... or the NucleoSpin Blood XL kit (Macherey-Nagel), as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Mini kit for DNA from blood (Macherey-Nagel) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel). The sgRNA loci were amplified with an indexing 5′ primer (5′-aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacNNNNNN gcacaaaaggaaactcaccct ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) and treated by DNase-free RNase A followed by ethanol precipitation ...
-
bioRxiv - Neuroscience 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) or QIAamp® DNA Mini (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the NucleoSpin Blood Kit (Macherey-Nagel; Dueren, DE) following the manufacturer’s protocol and used as template in diagnostic PCR ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we used the NucleoSpin Blood QuickPure Kit (Macherey-Nagel). Extract quality was first assessed on a 1.5% agarose gel to exclude extractions with insufficient yield or excessively degraded DNA ...
-
bioRxiv - Microbiology 2023Quote: Whole peripheral blood was collected from newly hatched chicks and total DNA was extracted using the NucleoSpin 96 Blood core kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... gDNA were extracted with NucleoSpin® Blood kit (Macherey-Nagel) and TCR sequencing was performed by Adaptive BiotechnologiesR (Seattle ...
-
bioRxiv - Genetics 2024Quote: ... DNAs were extracted using NucleoSpin Blood XL (Macherey-Nagel#740950). Samples were prepared for sequencing as previously described35.
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA was isolated using NucleoSpin Blood kits (Macherey-Nagel) and digested for 18 hours with SbfI-HF (NEB) ...
-
bioRxiv - Cell Biology 2024Quote: ... and CAP samples using NucleoSpin Blood XL kit (Macherey-Nagel) and prepared for sequencing on an Illumina HiSeq4000 as previously described21 ...
-
bioRxiv - Microbiology 2023Quote: ... one of which was treated with 20 µg/mL of Proteinase K (740506.75, Macherey-Nagel), and incubated at 37°C for 15 min ...
-
bioRxiv - Biophysics 2024Quote: ... One tube was treated with 20 µg/mL of proteinase K (Macherey-Nagel cat #740506). Proteinase K and untreated GPMVs were incubated for 45 min at 37° C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNA was extracted using a NucleoSpin Blood kit (Macherey-Nagel) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... gDNA was isolated using the NucleoSpin Blood Mini Kit (Macherey-Nagel). The gDNA concentrations were quantitated by Qubit.
-
A CRISPR activation screen identifies FBXO22 as an E3 ligase supporting targeted protein degradationbioRxiv - Biochemistry 2023Quote: ... Total DNA was extracted using NucleoSpin blood mini kit (MACHEREY-NAGEL). sgRNA was amplified by PCR using mixed P5 primer and P7 primer with i7 index sequence ...
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA was collected with Takara NucleoSpin Blood Kits (Macherey-Nagel), following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... De-crosslinking was performed by adding 20 µl Proteinase K (20 mg/ml, Macherey-Nagel, 740506) to the ligation mix (1.2 ml ...
-
bioRxiv - Microbiology 2020Quote: ... falciparum genomic DNA was isolated using NucleoSpin® Blood Columns (Macherey-Nagel) as per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: Genomic DNA (gDNA) was extracted using the NucleoSpin Blood kit (Macherey-Nagel). The sgRNA expression cassettes were amplified from gDNA in a two-step nested PCR using Q5 High-Fidelity 2X Master Mix (NEB) ...
-
bioRxiv - Neuroscience 2024Quote: ... or Macherey-Nagel Nucleospin Blood L kit (Macherey-Nagel; Cat. No. 740954.20), depending on the number of cells recovered from FACS ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted using the NucleoMag Blood 200 μL kit (Macherey-Nagel).
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA was extracted using Nucleospin Blood XL kit (Macherey-Nagel cat# 740950) and eluted into 1ml elution buffer ...
-
bioRxiv - Developmental Biology 2022Quote: Genomic DNA was isolated with Macherey-Nagel− NucleoSpin− Blood kit (740951.50, Macherey-Nagel) according to manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the Nucleo-Mag Blood 200 µl DNA Kit (Macherey-Nagel, Düren, Germany) was used for extraction and clean-up of genomic DNA ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was extracted using Nucleo Spin RNA Blood (Macherey-Nagel, Düren, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... Genomic DNA was extracted using the NucleoSpin® Blood Mini kit (Macherey-Nagel). The targeted loci were amplified with primers (oJAH262 and oJAH263 for HEK3_3a target site ...
-
bioRxiv - Cancer Biology 2024Quote: ... Single bacterial colony which survived in ampicillin agar LB medium was picked up for DNA plasmid extraction by Macherey-Nagel NucleoSpin Plasmid (#74049950) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmids were extracted from colonies selected on LB agar medium containing ampicillin (100 μg mL-1) using the NucleoSpin Plasmid extraction kit (Macherey-Nagel) following the manufacturer’s instructions ...