Labshake search
Citations for Macherey-Nagel GmbH :
151 - 200 of 2158 citations for 2'3' Cyclic GAMP cGAMP ELISA Kit 1 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... NucleoSpin® Plasmid EasyPure Kit (Macherey-Nagel, Germany) was used for plasmid preparation ...
-
bioRxiv - Microbiology 2021Quote: ... or cells (NucleoSpin RNA plus kit, Macherey-Nagel) at different time post-electroporation (4 hpe – 7 dpe) ...
-
bioRxiv - Microbiology 2021Quote: ... using the NucleoSpin Plasmid Mini Kit (Macherey-Nagel) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... or the NucleoSpin Blood XL kit (Macherey-Nagel), as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... produced using an endotoxin-free kit (Macherey-Nagel), were co-injected with the I-SceI meganuclease (Grabher et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... and NucleoSpin® RNA kit (Macherey-Nagel, #740955.250) according to the manufacturer’s instruction ...
-
bioRxiv - Biophysics 2022Quote: ... Plasmid preparation kits were purchased from Macherey-Nagel.
-
bioRxiv - Genomics 2022Quote: ... The Nucleospin® Tissue kit (Macherey-Nagel, Germany) was used for bacterial DNA extraction according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... were prepared by NucleoSpin RNA kit (Macherey-Nagel). Then rRNA depletion was performed with the RiboMinus Eukaryote System v2 (Invitrogen–Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... we used the Nucleospin Kit (Macherey-Nagel, USA) following manufacturer guidelines but with 60 µl instead of 100 µl of elution buffer added in the final step ...
-
bioRxiv - Molecular Biology 2020Quote: ... or a NucleoSpin RNA extraction kit (Macherey-Nagel), treated with Turbo DNase (Ambion) ...
-
bioRxiv - Genomics 2021Quote: ... Mini kit for DNA from blood (Macherey-Nagel) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... using the NucleoSpin RNA virus kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... using the NucleoSpin RNA Plus kit (MACHEREY-NAGEL GmbH & Co ...
-
bioRxiv - Genomics 2022Quote: ... or the NucleoMagVet kit (Macherey-Nagel, Düren, Germany) on a KingFisher® extraction platform (Thermo-Fisher-Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... kit with NTB binding buffer (#740595.150, Macherey-Nagel) according to the manufacturer’s instructions and eluted in 30 µL.
-
bioRxiv - Neuroscience 2023Quote: ... NucleoSpin RNA XS kit (Macherey-Nagel; Düren, Germany), or TRIzol Reagent with phenol-chloroform extraction (Thermo-Fisher Scientific ...
-
bioRxiv - Zoology 2023Quote: ... or the NucleoSpin® Tissue Kit (Macherey-Nagel). At least one specimen per site was sequenced for two standard markers ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel). The sgRNA loci were amplified with an indexing 5′ primer (5′-aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacNNNNNN gcacaaaaggaaactcaccct ...
-
bioRxiv - Genomics 2022Quote: ... NucleoSpin miRNA Plasma Kit (NUC; Macherey-Nagel, 740981.50), QIAamp ccfDNA/RNA Kit (CCF ...
-
bioRxiv - Developmental Biology 2023Quote: ... and protein extraction kit (Macherey-Nagel, Allentown, PA) (gene expression studies ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified using Nucleospin kit (Macherey-Nagel, Düren, Germany), and subcloned into pGEM-T plasmid ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) and treated by DNase-free RNase A followed by ethanol precipitation ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and plasmid kits were purchased from Macherey-Nagel. Precision Plus ProteinTM protein standard was provided by Biorad ...
-
bioRxiv - Neuroscience 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) or QIAamp® DNA Mini (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: ... using the NucleoSpin RNA purification kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... Plasmid preparation kits were purchased from Macherey-Nagel.
-
bioRxiv - Cell Biology 2023Quote: ... or NucleoBond Xtra Midi EF kit (MACHEREY-NAGEL).
-
bioRxiv - Microbiology 2024Quote: ... RNA extraction (Macherey-Nagel RNA extraction kit; Germany) was done according to supplier instructions ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Extracted steroids were concentrated under nitrogen and dissolved in 20 µl of trichloromethane for separation by thin-layer chromatography on silica gel TLC plates (Macherey-Nagel, Oensingen, Switzerland). Radiolabeled steroids were quantified by autoradiography on a Fuji FLA-7000 PhosphorImager (Fujifilm ...
-
bioRxiv - Plant Biology 2019Quote: Total RNA of seedlings was extracted using either the innuPREP Plant RNA kit (analytic-jena) or the NucleoSpin RNA Plant kit (Macherey-Nagel). If necessary ...
-
bioRxiv - Genetics 2021Quote: ... The lysates were then purified to genomic DNA and RNA using NucleoSpin Tissue Kits and NucleoSpin RNA Plus kits (MACHEREY-NAGEL), respectively ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting PCR product was purified using a standard PCR purification kit (NucleoSpin® Gel and PCR Clean-up kit, Macherey-Nagel) and used as a template for the second PCR that used the gene-specific forward primer and a 3’ T7 universal reverse primer targeting the forward linker sequence for the antisense probe ...
-
bioRxiv - Microbiology 2023Quote: ... exonuclease V was used to digest the linear DNA in the sample prior to isolation of the residual putative cirDNA using a DNA clean-up kit (NucleoSpin gel and PCR clean-up kit, Macherey-Nagel, Germany). The final cirDNA preparation was dissolved in TE buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA from CD11B+ cells was extracted using an RNA XS Plus extraction kit and that from brains using a NucleoSpin RNA extraction kit according to the manufacturers’ protocol (Macherey-Nagel®). Reverse transcription was performed using 350 ng (CD11B+ ...
-
A randomized multiplex CRISPRi-Seq approach for the identification of critical combinations of genesbioRxiv - Genetics 2023Quote: ... bacteria from the cultures used for infection were immediately pelleted by centrifugation and resuspended in 8 mL of RES-EF of the NucleoBond Xtra Midi EF kit prior to proceeding with the standard kit protocol (Macherey-Nagel 740420.50). Precipitated vectors were resuspended in 120 µL of water.
-
bioRxiv - Microbiology 2020Quote: ... coli using NucleoSpin Plasmid Kit (Macherey-Nagel, Düren, Germany). Deletion of the degU ...
-
bioRxiv - Evolutionary Biology 2021Quote: We used NucleoSpin Tissue kits (Macherey-Nagel, Düren, Germany) to extract and purify genomic DNA from the hind femur of each individual ...
-
bioRxiv - Developmental Biology 2020Quote: ... using NucleoSpin® RNA kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: For tissue extraction the RNA purification Kit (Macherey-Nagel) was used ...
-
bioRxiv - Molecular Biology 2021Quote: ... and a NucleoSpin RNA isolation kit (Macherey-Nagel, Germany). Hundreds of worms were collected for each experiment ...
-
bioRxiv - Molecular Biology 2019Quote: RNA was isolated with Nucleospin RNA kit (Macherey-Nagel) with DNase I treatment ...
-
bioRxiv - Microbiology 2020Quote: ... the NucleoSpin® Plasmid kit (Macherey-Nagel, Düren, Germany) was used ...
-
bioRxiv - Genomics 2021Quote: ... using the NucleoSpin Plasmid EasyPure kit #740727250 (Macherey-Nagel), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Fragments were gel purified (following kit instructions, Macherey-Nagel) and 30 ng of insert and 10 ng of vector ligated using 6U of T4 DNA ligase (Thermo ...
-
bioRxiv - Neuroscience 2020Quote: ... and NucleoBond Xtra Midi EF Kit (Macherey-Nagel, 740420.10) and verified them via Sanger sequencing ...
-
bioRxiv - Cancer Biology 2020Quote: ... or NucleoSpin Tissue kit (routine genotyping; Macherey-Nagel #740952.25). OneTaq DNA polymerase (New England BioLabs #M0480 ...
-
bioRxiv - Microbiology 2021Quote: ... purified (gel and PCR clean-up kit, Macherey-Nagel) and subsequently sequenced by the use of primers oRH068 ...
-
bioRxiv - Microbiology 2021Quote: ... ljungdahlii with the NucleoSpin Tissue Mini kit (Macherey-Nagel) and used as PCR-template ...
-
bioRxiv - Microbiology 2022Quote: ... NucleoSpin RNA virus kit (Macherey-Nagel; cat no. 740956.250) was used for RNA extraction.