Labshake search
Citations for Macherey-Nagel GmbH :
2051 - 2100 of 2293 citations for Pregnanediol 3 Glucuronide PDG ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... the DNA eluates were de-cross-linked at 65°C overnight with shaking at 900rpm and purified by NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel), according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2023Quote: ... RNA was extracted from 32 samples of male visceral adipose tissue using a NucleoSpin RNA kit (Macherey-Nagel GmbH & Co. KG). The samples were transferred to tubes with 1.4 mm ceramic beads (Omni International) ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1−/− embryos and their tie1+/? siblings using the NucleoSpin XS kit (Macherey-Nagel, 740902.50) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Clones whose culture had proven successful (IgG concentration ≥ 1 μg/mL at day 21-25) were selected and extracted using the NucleoSpin96 RNA extraction kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: RNA was successfully isolated from blood cells of 34 14-day-old great tits with NucleoSpin RNA Plus Kit (Macherey-Nagel). Packed blood cells (10 µl per sample ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was isolated from Kasumi-1 cells after 2 days after shRUNX1::ETO knockdown was induced with doxycycline using the Nucleospin RNA kit (Macherey-Nagel). cDNA was synthesised using Superscript II (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... All samples were immediately placed on dry ice and stored at −80 °C until DNA extraction using the NucleoSpin 96 soil kit (Macherey-Nagel) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The viruses were characterized by isolating viral RNA from 150-µL aliquots of the cell culture supernatant with the NucleoSpin RNA Virus kit (Macherey-Nagel) followed by conventional RT-PCR and bidirectional Sanger sequence analysis of the inserted SARS-CoV-2 sequences and flanking regions ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR products were visualized on a 1% TAE agarose gel and purified using the Nucleospin PCR Clean-up Kit (Macherey-Nagel) following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: Total RNA was isolated from 50–100 mg of snap-frozen liver tissue by the NucleoSpin RNA kit (Macherey-Nagel, 740955). Quality control was performed on an Agilent BioAnalyzer ...
-
bioRxiv - Evolutionary Biology 2023Quote: DNA was extracted from leaves using a mixed alkyl trimethylammonium bromide buffer (MATAB) and NucleoMag Plant Kit (Macherey-Nagel, Düren, Germany) as already described by Cormier et al ...
-
bioRxiv - Genomics 2023Quote: ... Transformed cells were grown in Kp medium for 8-10 vegetative divisions and their genomic DNA was extracted using the NucleoSpin Tissue kit (Macherey-Nagel). Transgene injection levels (copy number per haploid genome ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plates were scraped with 30-50 mL Luria-Bertani (LB) broth and plasmids were purified with Endotoxin-Free MaxiPrep kit (Macherey-Nagel). Precipitated DNA was resuspended in 1 mL water and the concentration was measured at Nanodrop ...
-
bioRxiv - Neuroscience 2023Quote: ... The positive clones were grown in 300 mL LB cultures and the plasmids were extracted using the NucleoBond Xtra Midi EF kit (Macherey-Nagel). The plasmids were sent out for sequencing again before being packaged into AAVs.
-
bioRxiv - Evolutionary Biology 2023Quote: ... Genomic DNA was extracted from 15 unsexed individuals conserved in alcohol using the Nucleobond AXG20 kit and buffer set IV from Macherey-Nagel (ref ...
-
bioRxiv - Plant Biology 2023Quote: ... Protein and mRNA were extracted from the same leaf sample (NucleoSpin RNA/Protein kit, REF740933, Macherey-Nagel GmbH & Co., Düren, Germany).
-
bioRxiv - Evolutionary Biology 2023Quote: ... total RNA was extracted from two pools of four entire emerging female wasps using the NucleoSpin®RNA kit (Macherey-Nagel). Total RNA was finally resuspended in 40µL of RNAse free water ...
-
bioRxiv - Evolutionary Biology 2023Quote: Whole DNA was extracted from fecal samples following the optimized protocol of (79) using the Genomic DNA from soil kit (NucleoSpin, Macherey-Nagel). Two successive extractions were done and a purification step was added to retrieve high molecular weight DNA suitable for long-read sequencing (79) ...
-
bioRxiv - Genomics 2023Quote: Total RNA was extracted from immature inflorescences (stages 1-12) or aerial parts of 16- day-old seedlings using NucleoSpin RNA Plus kit (Macherey-Nagel) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... The cloned BAC DNA was extracted using NucleoBond Xtra BAC kit for large construct plasmid DNA (Macherey-Nagel, catalog number 740436.25). For library cloning ...
-
bioRxiv - Microbiology 2023Quote: ... and 16S amplicons (500 bp amplicon size) were purified by agarose gel separation using the NucleoSpin Gel and PCR Clean-up purification kit (Macherey-Nagel). Bacterial 16S amplifications were obtained using the FastStart High-Fidelity PCR system (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... DNA purification from agarose gel or enzymatic reactions was performed with the NucleoSpin Gel and PCR clean up kit (Macherey-Nagel). PCRs were performed with Phusion DNA polymerase (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The correct bacterial cultures were processed the following day using the NucleoBond Xtra Midi kit for transfection-grade plasmid DNA (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... homogenized and frozen on dry ice in 350 μl of Buffer RA1 containing BME (Macherey-Nagel Nucleospin RNA isolation kit 740955), and stored at –80°C ...
-
bioRxiv - Bioengineering 2023Quote: ... supernatant was removed and cell pellets were used for plasmid isolation by using NucleoBond□ Xtra Midi Plasmid DNA Purification Kit (Macherey-Nagel) according to the protocol supplied by the kit.
-
bioRxiv - Microbiology 2023Quote: Genomic DNA of tick organs and eggs was extracted using the NucleoSpin Tissue kit according to the manufacturer’s instructions (Macherey-Nagel, Germany). DNA was eluted with 50 μL of elution buffer and was stored at -20°C until use.
-
bioRxiv - Evolutionary Biology 2023Quote: ... Three independent PCR reactions from the same library were combined after PCR and purified using a NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel). Sequencing was carried out on an Illumina HiSeq XTen at Macrogen ...
-
Prevention of tau accumulation through inhibition of hnRNP R-dependent axonal Mapt mRNA localizationbioRxiv - Neuroscience 2023Quote: ... Total RNA was extracted from the input sample and beads by adding 300 μl buffer A1 (NucleoSpin RNA kit, Macherey-Nagel) and 300 μl absolute ethanol followed by RNA extraction according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: RNA was isolated from T-REx-293 and A549 cells using the NucleoSpin RNA Mini kit for RNA purification (Macherey-Nagel). 500 ng of total RNA was used for cDNA synthesis using Maxima™ Reverse Transcriptase (ThermoFisher) ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was prepared from isolated colonic epithelial cells of Hsp60Δ/ΔIEC and Hsp60fl/fl mice on day 2 with the column-based NucleoSpin RNAII kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: The protein was purified under native conditions using the Protino Ni-NTA Agarose for His-tag protein purification Kit (Macherey-Nagel) with the gravity flow method ...
-
bioRxiv - Bioengineering 2024Quote: ... The PCR product was run on a 1% agarose gel and subsequently purified using the NucleoSpin Gel and PCR Cleanup kit (Macherey-Nagel) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR products for each single cell clone were combined and purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel). Afterward using a second round of PCR ...
-
bioRxiv - Plant Biology 2024Quote: ... glycines J2 worms following treatment with CPR1-dsRNA or GFP-dsRNA control using the Nucleospin microRNA kit (Macherey-Nagel, Hoerdt, France). First-strand cDNA was synthesized and served as a template for PCR ...
-
bioRxiv - Immunology 2024Quote: ... and immediately transferred to a tube containing 400 µL of RA1 lysis buffer from the Nucleospin 96 RNA core kit (Macherey-Nagel) and ∼20 1-mm glass beads (BioSpec) ...
-
bioRxiv - Immunology 2024Quote: ... The DNA donor fragment was PCR amplified and cleaned up prior to injection using the Gel & PCR Clean-Up Kit (Macherey-Nagel). One cell stage zebrafish embryos were injected with ∼1-2 nl of 2.5 ng/μl DNA donor fragment together with 12.5 ng/μl sgRNA (GGACAATTTTCATGACAAGA ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the resulting fragment was purified using the NucleoSpin Gel and PCR Clean-up kit according to the manufacturer’s instructions (Macherey-Nagel, 740609.250). The purified CASP3 gene fragment was ligated into the linearized pEGFP-N3 vector using the quick ligationTM kit according to the manufacturer’s instructions (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... Single colonies were grown in 5 ml liquid LB medium at 37 °C overnight and the plasmid DNA was extracted using NucleoSpin® Plasmid preparation kit according to the manufacturer’s instructions (Macherey-Nagel). Positive clones were identified by restriction digestion and DNA sequencing ...
-
bioRxiv - Microbiology 2024Quote: The genomic ssDNA was isolated from the ion exchange-purified sample of the phage using a Virus DNA kit (Macherey-Nagel). For sequencing on the Oxford Nanopore platform ...
-
bioRxiv - Immunology 2024Quote: Total RNA was extracted from cells at the indicated time points post stimulation and/or infection using the NucleoSpin RNA extraction kit (Macherey-Nagel) as directed by manufacturer ...
-
bioRxiv - Plant Biology 2024Quote: ... One hundred mg of ground tissue was used for total RNA extraction using NucleoSpin RNA Plant Kit (Macherey-Nagel, Hoerdt, France). After spectrometric quantification with a Nanodrop 2000 ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was extracted using NucleoSpin RNA Plant Kits and DNase I treatment according to the manufacturer’s instructions (Macherey-Nagel, Germany). Complementary DNA (cDNA ...
-
bioRxiv - Genomics 2024Quote: Total RNA was extracted from 100 mg of rosette leaves from ddm1-2 plants using the Nucleo-spin RNA Plant mini kit (Macherey-Nagel). Library preparation and Nanopore sequencing were performed as previously described (Domínguez et al ...
-
bioRxiv - Immunology 2021Quote: ... Positive clones were identified by colony PCR and the plasmids were isolated using NucleoSpin® Plasmid EasyPure kit (Macherey-Nagel, Düren, Germany). The DNA sequence of the cloned devil CIITA transcript was verified by Sanger sequencing using Big Dye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems (ABI) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmid DNA was purified from the remaining cultures using a NucleoSpin Plasmid (NoLid) high-pure plasmid mini prep kit (cat. no. 740499.50, Macherey-Nagel, Bethlehem, PA) according to vendor instructions and quantified using the Qubit dsDNA BR Assay (cat ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we removed the last segments of the caudal section and preserved it in 96% ethanol before DNA extraction using the NucleoSpin® 96 Tissue kit (Macherey-Nagel). It is worth noting that the ablation of the last segments of the caudal section of earthworms does not affect their survival due to their regeneration capacity (e.g ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was extracted from 50 to 250 EB collected at different time points using the NucleoSpin® RNA kit (Macherey-Nagel) following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: Genomic sequences of the StGBSSI gene (Gene ID from NCBI: 102577459) were obtained from leaf DNA extracted using the NucleoSpin Plant II kit (Macherey-Nagel, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... 8 pairs of ovaries were dissected from 6 day-old virgin females and total RNA were extracted using the NucleoSpin® RNA isolation kit (Macherey-Nagel), following the instructions of the manufacturer ...
-
bioRxiv - Genomics 2021Quote: ... embryos were ground in Tri-Reagent and RNA was purified using affinity chromatography (Nucleospin RNA Clean up kit, Macherey-Nagel, Duren, Germany). Potential contaminating DNA was removed by digestion with rDNase then RNA was purified using Beckman Coulter’s solid-phase reversible immobilization (SPRI ...