Labshake search
Citations for Macherey-Nagel GmbH :
2051 - 2100 of 2283 citations for Mouse Eukaryotic translation initiation factor 4E binding protein 3 EIF4EBP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Plates were scraped with 30-50 mL Luria-Bertani (LB) broth and plasmids were purified with Endotoxin-Free MaxiPrep kit (Macherey-Nagel). Precipitated DNA was resuspended in 1 mL water and the concentration was measured at Nanodrop ...
-
bioRxiv - Neuroscience 2023Quote: ... The positive clones were grown in 300 mL LB cultures and the plasmids were extracted using the NucleoBond Xtra Midi EF kit (Macherey-Nagel). The plasmids were sent out for sequencing again before being packaged into AAVs.
-
bioRxiv - Evolutionary Biology 2023Quote: ... Genomic DNA was extracted from 15 unsexed individuals conserved in alcohol using the Nucleobond AXG20 kit and buffer set IV from Macherey-Nagel (ref ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... total RNA was extracted from two pools of four entire emerging female wasps using the NucleoSpin®RNA kit (Macherey-Nagel). Total RNA was finally resuspended in 40µL of RNAse free water ...
-
bioRxiv - Evolutionary Biology 2023Quote: Whole DNA was extracted from fecal samples following the optimized protocol of (79) using the Genomic DNA from soil kit (NucleoSpin, Macherey-Nagel). Two successive extractions were done and a purification step was added to retrieve high molecular weight DNA suitable for long-read sequencing (79) ...
-
bioRxiv - Genomics 2023Quote: Total RNA was extracted from immature inflorescences (stages 1-12) or aerial parts of 16- day-old seedlings using NucleoSpin RNA Plus kit (Macherey-Nagel) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... The cloned BAC DNA was extracted using NucleoBond Xtra BAC kit for large construct plasmid DNA (Macherey-Nagel, catalog number 740436.25). For library cloning ...
-
bioRxiv - Microbiology 2023Quote: ... and 16S amplicons (500 bp amplicon size) were purified by agarose gel separation using the NucleoSpin Gel and PCR Clean-up purification kit (Macherey-Nagel). Bacterial 16S amplifications were obtained using the FastStart High-Fidelity PCR system (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... DNA purification from agarose gel or enzymatic reactions was performed with the NucleoSpin Gel and PCR clean up kit (Macherey-Nagel). PCRs were performed with Phusion DNA polymerase (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The correct bacterial cultures were processed the following day using the NucleoBond Xtra Midi kit for transfection-grade plasmid DNA (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... homogenized and frozen on dry ice in 350 μl of Buffer RA1 containing BME (Macherey-Nagel Nucleospin RNA isolation kit 740955), and stored at –80°C ...
-
bioRxiv - Bioengineering 2023Quote: ... supernatant was removed and cell pellets were used for plasmid isolation by using NucleoBond□ Xtra Midi Plasmid DNA Purification Kit (Macherey-Nagel) according to the protocol supplied by the kit.
-
bioRxiv - Microbiology 2023Quote: Genomic DNA of tick organs and eggs was extracted using the NucleoSpin Tissue kit according to the manufacturer’s instructions (Macherey-Nagel, Germany). DNA was eluted with 50 μL of elution buffer and was stored at -20°C until use.
-
bioRxiv - Evolutionary Biology 2023Quote: ... Three independent PCR reactions from the same library were combined after PCR and purified using a NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel). Sequencing was carried out on an Illumina HiSeq XTen at Macrogen ...
-
Prevention of tau accumulation through inhibition of hnRNP R-dependent axonal Mapt mRNA localizationbioRxiv - Neuroscience 2023Quote: ... Total RNA was extracted from the input sample and beads by adding 300 μl buffer A1 (NucleoSpin RNA kit, Macherey-Nagel) and 300 μl absolute ethanol followed by RNA extraction according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: RNA was isolated from T-REx-293 and A549 cells using the NucleoSpin RNA Mini kit for RNA purification (Macherey-Nagel). 500 ng of total RNA was used for cDNA synthesis using Maxima™ Reverse Transcriptase (ThermoFisher) ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was prepared from isolated colonic epithelial cells of Hsp60Δ/ΔIEC and Hsp60fl/fl mice on day 2 with the column-based NucleoSpin RNAII kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... The PCR product was run on a 1% agarose gel and subsequently purified using the NucleoSpin Gel and PCR Cleanup kit (Macherey-Nagel) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR products for each single cell clone were combined and purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel). Afterward using a second round of PCR ...
-
bioRxiv - Biophysics 2024Quote: ... using mouse genomic DNA as a template and primer pairs 5’CAAAGAGCTCCTCGTCCAGT3’ and 5’ ATGGACTCCAGGACCCAAGA3’ followed by a column purification using the NucleoSpinⓇ Gel and PCR Clean-up Kit (Macherey-Nagel). For the in vitro cleavage assay ...
-
bioRxiv - Plant Biology 2024Quote: ... glycines J2 worms following treatment with CPR1-dsRNA or GFP-dsRNA control using the Nucleospin microRNA kit (Macherey-Nagel, Hoerdt, France). First-strand cDNA was synthesized and served as a template for PCR ...
-
bioRxiv - Immunology 2024Quote: ... and immediately transferred to a tube containing 400 µL of RA1 lysis buffer from the Nucleospin 96 RNA core kit (Macherey-Nagel) and ∼20 1-mm glass beads (BioSpec) ...
-
bioRxiv - Immunology 2024Quote: ... The DNA donor fragment was PCR amplified and cleaned up prior to injection using the Gel & PCR Clean-Up Kit (Macherey-Nagel). One cell stage zebrafish embryos were injected with ∼1-2 nl of 2.5 ng/μl DNA donor fragment together with 12.5 ng/μl sgRNA (GGACAATTTTCATGACAAGA ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the resulting fragment was purified using the NucleoSpin Gel and PCR Clean-up kit according to the manufacturer’s instructions (Macherey-Nagel, 740609.250). The purified CASP3 gene fragment was ligated into the linearized pEGFP-N3 vector using the quick ligationTM kit according to the manufacturer’s instructions (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... Single colonies were grown in 5 ml liquid LB medium at 37 °C overnight and the plasmid DNA was extracted using NucleoSpin® Plasmid preparation kit according to the manufacturer’s instructions (Macherey-Nagel). Positive clones were identified by restriction digestion and DNA sequencing ...
-
bioRxiv - Microbiology 2024Quote: The genomic ssDNA was isolated from the ion exchange-purified sample of the phage using a Virus DNA kit (Macherey-Nagel). For sequencing on the Oxford Nanopore platform ...
-
bioRxiv - Immunology 2024Quote: Total RNA was extracted from cells at the indicated time points post stimulation and/or infection using the NucleoSpin RNA extraction kit (Macherey-Nagel) as directed by manufacturer ...
-
bioRxiv - Plant Biology 2024Quote: ... One hundred mg of ground tissue was used for total RNA extraction using NucleoSpin RNA Plant Kit (Macherey-Nagel, Hoerdt, France). After spectrometric quantification with a Nanodrop 2000 ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was extracted using NucleoSpin RNA Plant Kits and DNase I treatment according to the manufacturer’s instructions (Macherey-Nagel, Germany). Complementary DNA (cDNA ...
-
bioRxiv - Genomics 2024Quote: Total RNA was extracted from 100 mg of rosette leaves from ddm1-2 plants using the Nucleo-spin RNA Plant mini kit (Macherey-Nagel). Library preparation and Nanopore sequencing were performed as previously described (Domínguez et al ...
-
bioRxiv - Immunology 2021Quote: ... Positive clones were identified by colony PCR and the plasmids were isolated using NucleoSpin® Plasmid EasyPure kit (Macherey-Nagel, Düren, Germany). The DNA sequence of the cloned devil CIITA transcript was verified by Sanger sequencing using Big Dye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems (ABI) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmid DNA was purified from the remaining cultures using a NucleoSpin Plasmid (NoLid) high-pure plasmid mini prep kit (cat. no. 740499.50, Macherey-Nagel, Bethlehem, PA) according to vendor instructions and quantified using the Qubit dsDNA BR Assay (cat ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we removed the last segments of the caudal section and preserved it in 96% ethanol before DNA extraction using the NucleoSpin® 96 Tissue kit (Macherey-Nagel). It is worth noting that the ablation of the last segments of the caudal section of earthworms does not affect their survival due to their regeneration capacity (e.g ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was extracted from 50 to 250 EB collected at different time points using the NucleoSpin® RNA kit (Macherey-Nagel) following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: Genomic sequences of the StGBSSI gene (Gene ID from NCBI: 102577459) were obtained from leaf DNA extracted using the NucleoSpin Plant II kit (Macherey-Nagel, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... 8 pairs of ovaries were dissected from 6 day-old virgin females and total RNA were extracted using the NucleoSpin® RNA isolation kit (Macherey-Nagel), following the instructions of the manufacturer ...
-
bioRxiv - Genomics 2021Quote: ... embryos were ground in Tri-Reagent and RNA was purified using affinity chromatography (Nucleospin RNA Clean up kit, Macherey-Nagel, Duren, Germany). Potential contaminating DNA was removed by digestion with rDNase then RNA was purified using Beckman Coulter’s solid-phase reversible immobilization (SPRI ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was successfully extracted from pelvic fin tissue of 238 individuals (85.6%) out of 278 collected in August 2015 (i.e. survivors and non-survivors) using NucleoSpin® RNA kit (Macherey-Nagel, Düren, Germany) and ensuring RNA quality using the Agilent 2100 Bioanalyzer ...
-
bioRxiv - Microbiology 2021Quote: ... mitochondrial and nuclear genomes we extracted genomic DNA from Pb-GFP infected hepatocytes treated or not with infusion using a NuceolSpin Tissue kit (Macherey-Nagel, Germany) according to manufacturer’s manual ...
-
bioRxiv - Neuroscience 2020Quote: ... Gel extraction was performed to select for products between 200 – 1000 bp using the Nucleospin Gel and PCR Clean-up kit (Macherey-Nagel, 740609). Samples were eluted in 11 μL NF H2O ...
-
bioRxiv - Cancer Biology 2020Quote: ... All amplified PCR products were isolated using silica membrane spin column technique (NucleoSpin® Gel, PCR clean up kit Macherey-Nagel, Germany) and were eluted in 20 µl of nuclease free water ...
-
bioRxiv - Plant Biology 2021Quote: ... Labelling was performed by PCR using vector-specific DY-682-labelled primers followed by PCR purification with NucleoSpin® Gel and PCR Clean-up kit (MACHEREY-NAGEL). Gel shifts were visualized using a LiCor Odyssey imaging system at 700 nm.
-
bioRxiv - Cell Biology 2021Quote: ... Eluates were digested with proteinase K and RNAse A and DNA fragments were purified using a PCR purification kit (Macherey-Nagel, #740609).
-
bioRxiv - Microbiology 2020Quote: ... 200 μL of the permeabilized sample was then processed using the Machery-Nagel NucleoSpin Virus kit (Macherey-Nagel, Catalog # 740983.50 and 740983.250).
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted from a cell pellet obtained from 2-ml aliquots of the microbial cultures using the tissue DNA extraction kit (Macherey-Nagel, Germany). The amoA genes of AOB and AOA was amplified with primers amoA-1F/amoA-2R (66 ...
-
bioRxiv - Microbiology 2020Quote: ... Clonal virus populations were characterized by isolating viral RNA from 150 µl aliquots of the cell culture supernatant with the NucleoSpin® RNA Virus kit (MACHEREY-NAGEL) followed by conventional RT-PCR and bidirectional Sanger sequence analysis.
-
bioRxiv - Zoology 2021Quote: ... standard DNA extraction was performed using the NucleoSpin™ Plant II DNA extraction kit (Macherey-Nagel GmbH and Co., Düren NRW, Germany). A reasonable number (usually 30–70 ...
-
bioRxiv - Microbiology 2022Quote: ... Viral genome equivalents (vge) were determined by qPCR of DNA isolated from encapsidated virions isolated with NucleoSpin Blood kit QuickPure (Macherey-Nagel; 740569.250).
-
bioRxiv - Plant Biology 2021Quote: ... total RNA was extracted from root tissues of DKC-9144 and PG-2475 at three time points (15, 25 and 35 DAS) with or without PBZ using Nucleospin RNA plant kit (Pal et al., 2017) (Macherey-Nagel, Germany). cDNA synthesis and qPCR was performed as described previously (Pal et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the band with the expected size excised and purified using the NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel). The second PCR products were sent for Sanger sequencing to Eurofins Genomics and checked for quality ...