Labshake search
Citations for Macherey-Nagel GmbH :
2001 - 2050 of 2267 citations for Human Carboxyl Terminal PDZ Ligand Of Neuronal Nitric Oxide Synthase Protein NOS1AP ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... positive colonies were cultured in 100 ml of 2YT medium and prepped using a midi-scale commercial kit (Macherey-Nagel 740410100).
-
bioRxiv - Genomics 2023Quote: The genomic DNA was extracted from at least one million cells (typically 3 million, coverage 300x) using the NucleoSpin Tissue kit (Macherey-Nagel). To enrich for GBCs ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was isolated from confluent cells from one well of a 6-well plate with the NucleoSpin RNA isolation kit (Macherey-Nagel) according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... The positive clones were grown in 300 mL LB cultures and the plasmids were extracted using the NucleoBond Xtra Midi EF kit (Macherey-Nagel). The plasmids were sent out for sequencing again before being packaged into AAVs.
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from three replicates of PRMT7-KO2 and control PC3 cells was extracted using the NucleoSpin RNA kit (Macherey-Nagel). mRNA quality control checks and NGS for RNA-seq analysis were performed at the NIMgenetics facility (Madrid ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... gDNA was extracted from male and female individuals of larval or pupal stage by NucleoSpin Tissue kit (Macherey-Nagel, Düren, Germany) or NucleoSpin Tissue XS kit (Macherey-Nagel ...
-
Prevention of tau accumulation through inhibition of hnRNP R-dependent axonal Mapt mRNA localizationbioRxiv - Neuroscience 2023Quote: ... Total RNA was extracted from the input sample and beads by adding 300 μl buffer A1 (NucleoSpin RNA kit, Macherey-Nagel) and 300 μl absolute ethanol followed by RNA extraction according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... the DNA eluates were de-cross-linked at 65°C overnight with shaking at 900rpm and purified by NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel), according to the manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... PCR products were confirmed on 2% agarose gels and purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel). Purified PCR products were quantified using the Quant-iT dsDNA kit (Invitrogen ...
-
bioRxiv - Physiology 2023Quote: ... Products were run on 1% agarose gels and then gel-purified using the NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel) according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... The PCR products of correct size were purified by agarose gel electrophoresis (NucleoSpin Gel and PCR Clean-up Kit, Macherey-Nagel). The purified linear DNA was used for cloning of pTS040 by Gibson assembly (NEBuilder HiFi DNA Assembly Reaction ...
-
bioRxiv - Bioengineering 2023Quote: ... The amplified guide library plasmid was extracted using the Macherey-Nagel NucleoBond Xtra Maxi EF Kit (Macherey-Nagel, catalog no. 740424.10). To determine guide RNA representation ...
-
bioRxiv - Microbiology 2023Quote: PCR product from multiple reactions was accumulated and gel extracted from a 0.8% (w/v) TAE agarose gel using a Nucleospin Gel and PCR clean-up kit (Macherey-Nagel, 740609.250). Gels were cut without exposing the DNA to UV radiation damage or stain ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA extraction was performed in three biological replicates for each sample using the NucleoSpin® RNA Plant kit (MACHEREY-NAGEL), as recommended by the manufacturer ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from snap frozen tissue samples in RNAlater with the use of NucleoSpin kit according to the manufacturer’s instructions (NucleoSpin® RNA, Macherey-Nagel) and measured by NanoPhotometer®N60 (Implen) ...
-
bioRxiv - Physiology 2023Quote: ... RNA was extracted from 32 samples of male visceral adipose tissue using a NucleoSpin RNA kit (Macherey-Nagel GmbH & Co. KG). The samples were transferred to tubes with 1.4 mm ceramic beads (Omni International) ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1−/− embryos and their tie1+/? siblings using the NucleoSpin XS kit (Macherey-Nagel, 740902.50) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Genomic DNA was extracted from 15 unsexed individuals conserved in alcohol using the Nucleobond AXG20 kit and buffer set IV from Macherey-Nagel (ref ...
-
bioRxiv - Immunology 2023Quote: Clones whose culture had proven successful (IgG concentration ≥ 1 μg/mL at day 21-25) were selected and extracted using the NucleoSpin96 RNA extraction kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: RNA was successfully isolated from blood cells of 34 14-day-old great tits with NucleoSpin RNA Plus Kit (Macherey-Nagel). Packed blood cells (10 µl per sample ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was isolated from Kasumi-1 cells after 2 days after shRUNX1::ETO knockdown was induced with doxycycline using the Nucleospin RNA kit (Macherey-Nagel). cDNA was synthesised using Superscript II (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... All samples were immediately placed on dry ice and stored at −80 °C until DNA extraction using the NucleoSpin 96 soil kit (Macherey-Nagel) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The viruses were characterized by isolating viral RNA from 150-µL aliquots of the cell culture supernatant with the NucleoSpin RNA Virus kit (Macherey-Nagel) followed by conventional RT-PCR and bidirectional Sanger sequence analysis of the inserted SARS-CoV-2 sequences and flanking regions ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR products were visualized on a 1% TAE agarose gel and purified using the Nucleospin PCR Clean-up Kit (Macherey-Nagel) following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: Total RNA was isolated from 50–100 mg of snap-frozen liver tissue by the NucleoSpin RNA kit (Macherey-Nagel, 740955). Quality control was performed on an Agilent BioAnalyzer ...
-
bioRxiv - Evolutionary Biology 2023Quote: DNA was extracted from leaves using a mixed alkyl trimethylammonium bromide buffer (MATAB) and NucleoMag Plant Kit (Macherey-Nagel, Düren, Germany) as already described by Cormier et al ...
-
bioRxiv - Genomics 2023Quote: ... Transformed cells were grown in Kp medium for 8-10 vegetative divisions and their genomic DNA was extracted using the NucleoSpin Tissue kit (Macherey-Nagel). Transgene injection levels (copy number per haploid genome ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plates were scraped with 30-50 mL Luria-Bertani (LB) broth and plasmids were purified with Endotoxin-Free MaxiPrep kit (Macherey-Nagel). Precipitated DNA was resuspended in 1 mL water and the concentration was measured at Nanodrop ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... total RNA was extracted from two pools of four entire emerging female wasps using the NucleoSpin®RNA kit (Macherey-Nagel). Total RNA was finally resuspended in 40µL of RNAse free water ...
-
bioRxiv - Evolutionary Biology 2023Quote: Whole DNA was extracted from fecal samples following the optimized protocol of (79) using the Genomic DNA from soil kit (NucleoSpin, Macherey-Nagel). Two successive extractions were done and a purification step was added to retrieve high molecular weight DNA suitable for long-read sequencing (79) ...
-
bioRxiv - Genomics 2023Quote: Total RNA was extracted from immature inflorescences (stages 1-12) or aerial parts of 16- day-old seedlings using NucleoSpin RNA Plus kit (Macherey-Nagel) following the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2024Quote: HIV RNA was extracted from plasma samples collected from either HIV-1 infected or uninfected humanized hNSG mice transplanted with CD4+ T cells from PWH in the absence or presence of immunotherapy using NucleospinTM RNA Virus kit (Cultek, Macherey-Nagel) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was isolated from whole plant tissue ground in liquid nitrogen using the Nucleospin RNA Plant Kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The cloned BAC DNA was extracted using NucleoBond Xtra BAC kit for large construct plasmid DNA (Macherey-Nagel, catalog number 740436.25). For library cloning ...
-
bioRxiv - Microbiology 2023Quote: ... and 16S amplicons (500 bp amplicon size) were purified by agarose gel separation using the NucleoSpin Gel and PCR Clean-up purification kit (Macherey-Nagel). Bacterial 16S amplifications were obtained using the FastStart High-Fidelity PCR system (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... DNA purification from agarose gel or enzymatic reactions was performed with the NucleoSpin Gel and PCR clean up kit (Macherey-Nagel). PCRs were performed with Phusion DNA polymerase (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The correct bacterial cultures were processed the following day using the NucleoBond Xtra Midi kit for transfection-grade plasmid DNA (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and 300 mg (JFC) of both fresh and treated frass (n = 3) using the NucleoSpin Soil Kit (Macherey-Nagel, Düren, Germany) and following the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... supernatant was removed and cell pellets were used for plasmid isolation by using NucleoBond□ Xtra Midi Plasmid DNA Purification Kit (Macherey-Nagel) according to the protocol supplied by the kit.
-
bioRxiv - Immunology 2023Quote: RNAs from whole lungs or BM of naive or IAV-infected mice were extracted and purified using the NucleoSpin RNA Extraction Kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was prepared from isolated colonic epithelial cells of Hsp60Δ/ΔIEC and Hsp60fl/fl mice on day 2 with the column-based NucleoSpin RNAII kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmids were propagated in cultures of terrific broth medium with appropriate antibiotics overnight at 37 °C and purified with NucleoSpin miniprep kit (Macherey-Nagel) following the manufacturer’s prototol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Three independent PCR reactions from the same library were combined after PCR and purified using a NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel). Sequencing was carried out on an Illumina HiSeq XTen at Macrogen ...
-
bioRxiv - Microbiology 2023Quote: Genomic DNA of tick organs and eggs was extracted using the NucleoSpin Tissue kit according to the manufacturer’s instructions (Macherey-Nagel, Germany). DNA was eluted with 50 μL of elution buffer and was stored at -20°C until use.
-
bioRxiv - Plant Biology 2024Quote: ... One hundred mg of ground tissue was used for total RNA extraction using NucleoSpin RNA Plant Kit (Macherey-Nagel, Hoerdt, France). After spectrometric quantification with a Nanodrop 2000 ...
-
bioRxiv - Bioengineering 2024Quote: ... The PCR product was run on a 1% agarose gel and subsequently purified using the NucleoSpin Gel and PCR Cleanup kit (Macherey-Nagel) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... glycines J2 worms following treatment with CPR1-dsRNA or GFP-dsRNA control using the Nucleospin microRNA kit (Macherey-Nagel, Hoerdt, France). First-strand cDNA was synthesized and served as a template for PCR ...
-
bioRxiv - Immunology 2024Quote: ... The DNA donor fragment was PCR amplified and cleaned up prior to injection using the Gel & PCR Clean-Up Kit (Macherey-Nagel). One cell stage zebrafish embryos were injected with ∼1-2 nl of 2.5 ng/μl DNA donor fragment together with 12.5 ng/μl sgRNA (GGACAATTTTCATGACAAGA ...
-
bioRxiv - Immunology 2024Quote: ... and immediately transferred to a tube containing 400 µL of RA1 lysis buffer from the Nucleospin 96 RNA core kit (Macherey-Nagel) and ∼20 1-mm glass beads (BioSpec) ...
-
bioRxiv - Biophysics 2024Quote: ... using mouse genomic DNA as a template and primer pairs 5’CAAAGAGCTCCTCGTCCAGT3’ and 5’ ATGGACTCCAGGACCCAAGA3’ followed by a column purification using the NucleoSpinⓇ Gel and PCR Clean-up Kit (Macherey-Nagel). For the in vitro cleavage assay ...