Labshake search
Citations for Macherey-Nagel GmbH :
1951 - 2000 of 2219 citations for Mouse Neuropeptide FF NPFF CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Pooled libraries were concentrated by ethanol precipitation and purified by gel extraction of the corresponding library size using the NucleoSpin Gel and PCR Clean-up Mini kit (Macherey-Nagel). Libraries were sequenced using the MiSeq Reagent Kit v3 with 300-bp paired end reads on a MiSeq (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from snap frozen tissue samples in RNAlater with the use of NucleoSpin kit according to the manufacturer’s instructions (NucleoSpin® RNA, Macherey-Nagel) and measured by NanoPhotometer®N60 (Implen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... positive colonies were cultured in 100 ml of 2YT medium and prepped using a midi-scale commercial kit (Macherey-Nagel 740410100).
-
bioRxiv - Cell Biology 2023Quote: ... RNA was isolated from confluent cells from one well of a 6-well plate with the NucleoSpin RNA isolation kit (Macherey-Nagel) according to manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA extraction was performed in three biological replicates for each sample using the NucleoSpin® RNA Plant kit (MACHEREY-NAGEL), as recommended by the manufacturer ...
-
bioRxiv - Systems Biology 2023Quote: ... The PCR products of correct size were purified by agarose gel electrophoresis (NucleoSpin Gel and PCR Clean-up Kit, Macherey-Nagel). The purified linear DNA was used for cloning of pTS040 by Gibson assembly (NEBuilder HiFi DNA Assembly Reaction ...
-
bioRxiv - Microbiology 2023Quote: PCR product from multiple reactions was accumulated and gel extracted from a 0.8% (w/v) TAE agarose gel using a Nucleospin Gel and PCR clean-up kit (Macherey-Nagel, 740609.250). Gels were cut without exposing the DNA to UV radiation damage or stain ...
-
bioRxiv - Bioengineering 2023Quote: ... The amplified guide library plasmid was extracted using the Macherey-Nagel NucleoBond Xtra Maxi EF Kit (Macherey-Nagel, catalog no. 740424.10). To determine guide RNA representation ...
-
bioRxiv - Physiology 2023Quote: ... Products were run on 1% agarose gels and then gel-purified using the NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel) according to manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... PCR products were confirmed on 2% agarose gels and purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel). Purified PCR products were quantified using the Quant-iT dsDNA kit (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... gDNA was extracted from male and female individuals of larval or pupal stage by NucleoSpin Tissue kit (Macherey-Nagel, Düren, Germany) or NucleoSpin Tissue XS kit (Macherey-Nagel ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from three replicates of PRMT7-KO2 and control PC3 cells was extracted using the NucleoSpin RNA kit (Macherey-Nagel). mRNA quality control checks and NGS for RNA-seq analysis were performed at the NIMgenetics facility (Madrid ...
-
bioRxiv - Molecular Biology 2023Quote: ... the DNA eluates were de-cross-linked at 65°C overnight with shaking at 900rpm and purified by NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel), according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2023Quote: ... RNA was extracted from 32 samples of male visceral adipose tissue using a NucleoSpin RNA kit (Macherey-Nagel GmbH & Co. KG). The samples were transferred to tubes with 1.4 mm ceramic beads (Omni International) ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1−/− embryos and their tie1+/? siblings using the NucleoSpin XS kit (Macherey-Nagel, 740902.50) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Clones whose culture had proven successful (IgG concentration ≥ 1 μg/mL at day 21-25) were selected and extracted using the NucleoSpin96 RNA extraction kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: RNA was successfully isolated from blood cells of 34 14-day-old great tits with NucleoSpin RNA Plus Kit (Macherey-Nagel). Packed blood cells (10 µl per sample ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was isolated from Kasumi-1 cells after 2 days after shRUNX1::ETO knockdown was induced with doxycycline using the Nucleospin RNA kit (Macherey-Nagel). cDNA was synthesised using Superscript II (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... All samples were immediately placed on dry ice and stored at −80 °C until DNA extraction using the NucleoSpin 96 soil kit (Macherey-Nagel) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The viruses were characterized by isolating viral RNA from 150-µL aliquots of the cell culture supernatant with the NucleoSpin RNA Virus kit (Macherey-Nagel) followed by conventional RT-PCR and bidirectional Sanger sequence analysis of the inserted SARS-CoV-2 sequences and flanking regions ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR products were visualized on a 1% TAE agarose gel and purified using the Nucleospin PCR Clean-up Kit (Macherey-Nagel) following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: Total RNA was isolated from 50–100 mg of snap-frozen liver tissue by the NucleoSpin RNA kit (Macherey-Nagel, 740955). Quality control was performed on an Agilent BioAnalyzer ...
-
bioRxiv - Evolutionary Biology 2023Quote: DNA was extracted from leaves using a mixed alkyl trimethylammonium bromide buffer (MATAB) and NucleoMag Plant Kit (Macherey-Nagel, Düren, Germany) as already described by Cormier et al ...
-
bioRxiv - Genomics 2023Quote: ... Transformed cells were grown in Kp medium for 8-10 vegetative divisions and their genomic DNA was extracted using the NucleoSpin Tissue kit (Macherey-Nagel). Transgene injection levels (copy number per haploid genome ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plates were scraped with 30-50 mL Luria-Bertani (LB) broth and plasmids were purified with Endotoxin-Free MaxiPrep kit (Macherey-Nagel). Precipitated DNA was resuspended in 1 mL water and the concentration was measured at Nanodrop ...
-
bioRxiv - Genomics 2023Quote: The genomic DNA was extracted from at least one million cells (typically 3 million, coverage 300x) using the NucleoSpin Tissue kit (Macherey-Nagel). To enrich for GBCs ...
-
bioRxiv - Neuroscience 2023Quote: ... The positive clones were grown in 300 mL LB cultures and the plasmids were extracted using the NucleoBond Xtra Midi EF kit (Macherey-Nagel). The plasmids were sent out for sequencing again before being packaged into AAVs.
-
bioRxiv - Evolutionary Biology 2023Quote: ... Genomic DNA was extracted from 15 unsexed individuals conserved in alcohol using the Nucleobond AXG20 kit and buffer set IV from Macherey-Nagel (ref ...
-
bioRxiv - Plant Biology 2023Quote: ... Protein and mRNA were extracted from the same leaf sample (NucleoSpin RNA/Protein kit, REF740933, Macherey-Nagel GmbH & Co., Düren, Germany).
-
bioRxiv - Evolutionary Biology 2023Quote: ... total RNA was extracted from two pools of four entire emerging female wasps using the NucleoSpin®RNA kit (Macherey-Nagel). Total RNA was finally resuspended in 40µL of RNAse free water ...
-
bioRxiv - Evolutionary Biology 2023Quote: Whole DNA was extracted from fecal samples following the optimized protocol of (79) using the Genomic DNA from soil kit (NucleoSpin, Macherey-Nagel). Two successive extractions were done and a purification step was added to retrieve high molecular weight DNA suitable for long-read sequencing (79) ...
-
bioRxiv - Genomics 2023Quote: Total RNA was extracted from immature inflorescences (stages 1-12) or aerial parts of 16- day-old seedlings using NucleoSpin RNA Plus kit (Macherey-Nagel) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... The cloned BAC DNA was extracted using NucleoBond Xtra BAC kit for large construct plasmid DNA (Macherey-Nagel, catalog number 740436.25). For library cloning ...
-
bioRxiv - Microbiology 2023Quote: ... and 16S amplicons (500 bp amplicon size) were purified by agarose gel separation using the NucleoSpin Gel and PCR Clean-up purification kit (Macherey-Nagel). Bacterial 16S amplifications were obtained using the FastStart High-Fidelity PCR system (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... DNA purification from agarose gel or enzymatic reactions was performed with the NucleoSpin Gel and PCR clean up kit (Macherey-Nagel). PCRs were performed with Phusion DNA polymerase (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The correct bacterial cultures were processed the following day using the NucleoBond Xtra Midi kit for transfection-grade plasmid DNA (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... homogenized and frozen on dry ice in 350 μl of Buffer RA1 containing BME (Macherey-Nagel Nucleospin RNA isolation kit 740955), and stored at –80°C ...
-
bioRxiv - Bioengineering 2023Quote: ... supernatant was removed and cell pellets were used for plasmid isolation by using NucleoBond□ Xtra Midi Plasmid DNA Purification Kit (Macherey-Nagel) according to the protocol supplied by the kit.
-
bioRxiv - Microbiology 2023Quote: Genomic DNA of tick organs and eggs was extracted using the NucleoSpin Tissue kit according to the manufacturer’s instructions (Macherey-Nagel, Germany). DNA was eluted with 50 μL of elution buffer and was stored at -20°C until use.
-
bioRxiv - Evolutionary Biology 2023Quote: ... Three independent PCR reactions from the same library were combined after PCR and purified using a NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel). Sequencing was carried out on an Illumina HiSeq XTen at Macrogen ...
-
Prevention of tau accumulation through inhibition of hnRNP R-dependent axonal Mapt mRNA localizationbioRxiv - Neuroscience 2023Quote: ... Total RNA was extracted from the input sample and beads by adding 300 μl buffer A1 (NucleoSpin RNA kit, Macherey-Nagel) and 300 μl absolute ethanol followed by RNA extraction according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: RNA was isolated from T-REx-293 and A549 cells using the NucleoSpin RNA Mini kit for RNA purification (Macherey-Nagel). 500 ng of total RNA was used for cDNA synthesis using Maxima™ Reverse Transcriptase (ThermoFisher) ...
-
bioRxiv - Microbiology 2023Quote: ... and 300 mg (JFC) of both fresh and treated frass (n = 3) using the NucleoSpin Soil Kit (Macherey-Nagel, Düren, Germany) and following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was prepared from isolated colonic epithelial cells of Hsp60Δ/ΔIEC and Hsp60fl/fl mice on day 2 with the column-based NucleoSpin RNAII kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: The protein was purified under native conditions using the Protino Ni-NTA Agarose for His-tag protein purification Kit (Macherey-Nagel) with the gravity flow method ...
-
bioRxiv - Bioengineering 2024Quote: ... The PCR product was run on a 1% agarose gel and subsequently purified using the NucleoSpin Gel and PCR Cleanup kit (Macherey-Nagel) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR products for each single cell clone were combined and purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel). Afterward using a second round of PCR ...
-
bioRxiv - Biophysics 2024Quote: ... using mouse genomic DNA as a template and primer pairs 5’CAAAGAGCTCCTCGTCCAGT3’ and 5’ ATGGACTCCAGGACCCAAGA3’ followed by a column purification using the NucleoSpinⓇ Gel and PCR Clean-up Kit (Macherey-Nagel). For the in vitro cleavage assay ...
-
bioRxiv - Plant Biology 2024Quote: ... glycines J2 worms following treatment with CPR1-dsRNA or GFP-dsRNA control using the Nucleospin microRNA kit (Macherey-Nagel, Hoerdt, France). First-strand cDNA was synthesized and served as a template for PCR ...
-
bioRxiv - Immunology 2024Quote: ... and immediately transferred to a tube containing 400 µL of RA1 lysis buffer from the Nucleospin 96 RNA core kit (Macherey-Nagel) and ∼20 1-mm glass beads (BioSpec) ...